ID: 1062421532

View in Genome Browser
Species Human (GRCh38)
Location 9:136484676-136484698
Sequence TGCACCGCCTGCGGCCCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 187}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062421532_1062421536 -5 Left 1062421532 9:136484676-136484698 CCAGCAGGGCCGCAGGCGGTGCA 0: 1
1: 0
2: 1
3: 9
4: 187
Right 1062421536 9:136484694-136484716 GTGCAGGGAGAGCTTCAGTCCGG 0: 1
1: 0
2: 2
3: 18
4: 220
1062421532_1062421538 11 Left 1062421532 9:136484676-136484698 CCAGCAGGGCCGCAGGCGGTGCA 0: 1
1: 0
2: 1
3: 9
4: 187
Right 1062421538 9:136484710-136484732 AGTCCGGCTGACGTGGCACCAGG 0: 1
1: 0
2: 0
3: 4
4: 48
1062421532_1062421539 12 Left 1062421532 9:136484676-136484698 CCAGCAGGGCCGCAGGCGGTGCA 0: 1
1: 0
2: 1
3: 9
4: 187
Right 1062421539 9:136484711-136484733 GTCCGGCTGACGTGGCACCAGGG 0: 1
1: 0
2: 0
3: 3
4: 52
1062421532_1062421537 4 Left 1062421532 9:136484676-136484698 CCAGCAGGGCCGCAGGCGGTGCA 0: 1
1: 0
2: 1
3: 9
4: 187
Right 1062421537 9:136484703-136484725 GAGCTTCAGTCCGGCTGACGTGG 0: 1
1: 0
2: 0
3: 5
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062421532 Original CRISPR TGCACCGCCTGCGGCCCTGC TGG (reversed) Exonic
900173474 1:1281695-1281717 TGCTCTGACTGAGGCCCTGCAGG + Intronic
900199755 1:1399200-1399222 AGCACCCCCTGCGACCCTGAGGG + Exonic
900287557 1:1908889-1908911 GGCGCCGGCTGCGGCCCCGCAGG - Intergenic
901188374 1:7389300-7389322 TGCTCCCCCTGCAGCCCTGCTGG + Intronic
901302733 1:8211333-8211355 TGCACCGCCTGCGTGGGTGCTGG - Intergenic
902359217 1:15932988-15933010 TGCAGCGCCTGTGCACCTGCGGG - Exonic
902544893 1:17184022-17184044 GGCATCGCCTGAGGCCCTTCTGG + Intergenic
907444436 1:54498965-54498987 TGCACATCCAGCTGCCCTGCAGG + Intergenic
914335908 1:146714814-146714836 TGCACTGCCTGGCTCCCTGCTGG + Intergenic
915894426 1:159800483-159800505 TGCCCCAGCTGCTGCCCTGCAGG + Intergenic
918853241 1:189718628-189718650 TGCAGCGCTTGCGGGCCAGCTGG - Intergenic
920312040 1:205054239-205054261 TGCACCGGCTGTAGCCTTGCAGG - Intronic
922473198 1:225889043-225889065 TGCAGCCCCTGTGGCTCTGCTGG - Exonic
923094291 1:230762394-230762416 TGCATCGCCTGCGGCTTTGATGG + Intronic
924582492 1:245334539-245334561 TGCAAAGCCAGCTGCCCTGCAGG + Intronic
1064197758 10:13259635-13259657 TGCAGCGCTTGCGGGCCAGCTGG + Intergenic
1068291445 10:55006664-55006686 TGCCCAGCCTGCGGCTTTGCAGG - Intronic
1070696282 10:78565859-78565881 TGCACAGCATGCAGCTCTGCAGG - Intergenic
1071387973 10:85141429-85141451 TGCAGCGCTTGCGGGCCAGCTGG + Intergenic
1074065463 10:110008554-110008576 TGCACGGCCTGCGGCGCCGCCGG + Intronic
1074999202 10:118782932-118782954 TGCAGCGCTTGCGGGCCAGCTGG + Intergenic
1075788808 10:125068781-125068803 AGTACCTCCTGCAGCCCTGCTGG - Intronic
1076854252 10:133108166-133108188 TGCAGGACCTGCTGCCCTGCTGG + Intronic
1076876529 10:133218990-133219012 TGAGCCTCCTGCGGCCGTGCGGG - Intronic
1077152460 11:1078398-1078420 GGCACCGGCAGCGGTCCTGCTGG - Intergenic
1077173860 11:1180085-1180107 TGCCCTGCCTGCGCACCTGCCGG + Intronic
1077204130 11:1333579-1333601 TGCAGCTCCTGCTGCACTGCTGG - Intergenic
1077844872 11:6013354-6013376 TGCCCAGCTCGCGGCCCTGCAGG + Intergenic
1078795792 11:14591092-14591114 TGCAGCGCTTGCGGGCCAGCTGG + Intronic
1080008003 11:27429912-27429934 TGTTCCCCCTGCAGCCCTGCAGG + Intronic
1083625433 11:64069674-64069696 TGCTCTGCCTGTGCCCCTGCAGG - Intronic
1085456344 11:76667562-76667584 GGCAGCGCCTGTGGCCCTGAGGG - Intronic
1087125176 11:94618391-94618413 TTCACTGCCAGCAGCCCTGCAGG - Intronic
1090229191 11:125089527-125089549 TGCAGCGCTTGCGGGCCAGCTGG + Intronic
1092123498 12:6060406-6060428 TGCACCGCCTCTGCCCCAGCTGG + Intronic
1092260706 12:6951961-6951983 CTCACCGCCTGGTGCCCTGCAGG + Exonic
1096503572 12:52079864-52079886 TGCACCGCGCGCGGCCCCTCGGG - Intergenic
1099286275 12:80717041-80717063 TGCACCGCCTGCCTCTCAGCAGG + Exonic
1100168562 12:91946245-91946267 GGCACCGCCTGGGAACCTGCTGG - Intergenic
1102603840 12:114053574-114053596 CCCACCGCCTGCTGCCCCGCAGG - Intergenic
1103649589 12:122422462-122422484 GGCACCCCCTGCTCCCCTGCCGG - Intronic
1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG + Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1111072283 13:83184277-83184299 TGCAAAGCCTGCAGCCCTGGCGG + Intergenic
1111841447 13:93455116-93455138 TGCGCCGCTTGCGGGCCAGCTGG - Intronic
1113482717 13:110633360-110633382 TGCAGCGCTTGCGGGCCAGCTGG - Intronic
1113778178 13:112960827-112960849 TGAGCCTCCTGCTGCCCTGCTGG + Intronic
1113814330 13:113161162-113161184 GGCACTGCCTGTGGCCCTGGTGG - Intronic
1113850873 13:113417263-113417285 TGCACGACCTGGGGCCCTGGTGG - Intergenic
1113932747 13:113976856-113976878 GACACTGCCTGAGGCCCTGCCGG + Intergenic
1121104570 14:91272007-91272029 GCCACCGCCAGCTGCCCTGCAGG + Exonic
1122375321 14:101253269-101253291 AGCACGGCGTCCGGCCCTGCCGG - Intergenic
1122784785 14:104158651-104158673 TGCCAGGCCTGAGGCCCTGCAGG + Intronic
1122985828 14:105211235-105211257 AGCACCGCCTGGGGCCTGGCAGG + Exonic
1123025864 14:105423623-105423645 GGCAGAGCCCGCGGCCCTGCAGG - Intronic
1123783016 15:23645660-23645682 GGCACCGCCTGCAGTCTTGCAGG - Exonic
1124500902 15:30225588-30225610 GGCCCCGCCTCCGGCCCTCCTGG - Intergenic
1124625286 15:31304212-31304234 GGCACCGCCTGAGAACCTGCAGG + Intergenic
1124742668 15:32313079-32313101 GGCCCCGCCTCCGGCCCTCCTGG + Intergenic
1125506808 15:40272005-40272027 TGCCCAGCCTGGTGCCCTGCGGG + Intronic
1125723921 15:41858587-41858609 TGCAGCGGGTGAGGCCCTGCAGG - Exonic
1127224756 15:56918137-56918159 TGCGCCGACTGCAGCCCTCCTGG + Intronic
1127984853 15:64061295-64061317 AGCTCCACCTGCGGCCCTGGTGG + Intronic
1128081095 15:64857286-64857308 TGTACAGCCTGTGGCCCTTCAGG + Intronic
1128114435 15:65096481-65096503 TCCACTGACTGGGGCCCTGCAGG + Intronic
1129450984 15:75651327-75651349 TGCACAGCCTGTGGCCCGGCTGG + Intronic
1129824717 15:78627113-78627135 TGTGCAGCCTGGGGCCCTGCTGG - Intronic
1131248645 15:90817085-90817107 GGCACAGCCTGCGACCCTGAGGG - Intergenic
1132692786 16:1189033-1189055 GGCACCGCCTGTGGCCATGGTGG - Intronic
1134069834 16:11254305-11254327 TACACCACCTGCAGCCCAGCAGG + Intronic
1136356685 16:29748649-29748671 TGCACCGCCCCCTGCTCTGCGGG + Intergenic
1139997716 16:70996409-70996431 TGCACTGCCTGGCTCCCTGCTGG - Intronic
1141714542 16:85719220-85719242 TGCAGCACCTGGGGCCATGCAGG - Intronic
1141749204 16:85946942-85946964 TGCACTGCCTGCCTCCATGCTGG + Intergenic
1141882448 16:86868931-86868953 AGCACAGCCTGCAGCCCTGAAGG + Intergenic
1142228399 16:88888441-88888463 TGAAGGGGCTGCGGCCCTGCAGG + Intronic
1142697084 17:1639719-1639741 TGCAACGCCTCCTGCCCAGCCGG - Exonic
1145018446 17:19413321-19413343 CGCCCCACCTGCAGCCCTGCAGG - Exonic
1145978808 17:28999448-28999470 TGCAGAGCCTGCAGCCTTGCTGG - Intronic
1146686714 17:34845988-34846010 GGCACCGCCTGAGGCCTTCCAGG - Intergenic
1147757364 17:42777927-42777949 TGTTCCCCCTGCTGCCCTGCAGG + Intronic
1150778246 17:68099313-68099335 TGCAGCGCTTGCGGGCCAGCTGG + Intergenic
1151820259 17:76493220-76493242 TTCCCTGCCTGTGGCCCTGCTGG + Intronic
1152685536 17:81691936-81691958 GGCACCGGCCGCGGCCCCGCAGG - Intronic
1152753433 17:82077185-82077207 TCCACAGCCTCAGGCCCTGCAGG - Intergenic
1152797715 17:82316254-82316276 TGCCCTCCCTGCGGCCCTGGCGG - Exonic
1152921326 17:83067967-83067989 TGCACAGCCTGTGGCTCTCCCGG - Intergenic
1153323146 18:3792917-3792939 TCCTCCACCTGCGGCACTGCTGG + Intronic
1153822566 18:8844768-8844790 TGCCCCGCCTGCAGCCCCCCGGG - Intergenic
1153868788 18:9297346-9297368 TGCTCCGCCTGTGGCCCTGGTGG + Intergenic
1157085937 18:44580763-44580785 TGCAGCGCTTGCGGGCCAGCTGG + Intergenic
1159444746 18:68528036-68528058 TGCAGCTCCTGCTGCCCTGTAGG + Intergenic
1160569255 18:79805648-79805670 TGTACCACCTGGCGCCCTGCAGG + Intergenic
1160726610 19:620472-620494 TCCACCACTTTCGGCCCTGCGGG + Exonic
1160838387 19:1135528-1135550 TGCGCCGCCTAGGGACCTGCTGG + Intronic
1161105435 19:2441529-2441551 TGCGAGCCCTGCGGCCCTGCTGG + Intronic
1161222880 19:3126106-3126128 TGCTCTGCCTGCGTCCCTCCAGG - Intergenic
1161459549 19:4388708-4388730 TGCACCTGCTGCTGCCCGGCTGG - Intronic
1161681541 19:5682136-5682158 TGCACCCCATGAGGCCCTGCAGG - Intronic
1165941450 19:39416614-39416636 GGCACAGCCTGAGGCCCAGCAGG - Intronic
1165942498 19:39422174-39422196 TGCACCCCCTGAGGACCTGGAGG + Exonic
1166998712 19:46732410-46732432 CTCACTGCCTGCGGCCATGCCGG + Intronic
1167037940 19:47005308-47005330 TGCAGCTCCTGCGGCCATGGGGG - Intergenic
1167505198 19:49867525-49867547 TGCCCCGCCTGCAACCCGGCCGG + Exonic
925160310 2:1678730-1678752 TGCCCCACCTGCGTCCCTGAAGG - Intronic
925987602 2:9229220-9229242 TGCCCCGCCACCAGCCCTGCAGG - Intronic
928493053 2:31803749-31803771 TGCAGCGCTTGCGGGCCAGCTGG + Intergenic
929379654 2:41335620-41335642 TGCAGCGCTTGCGGGCCAGCTGG + Intergenic
929603375 2:43218769-43218791 TGCCCGGCCTGCTGCCCTGCAGG + Intergenic
930485473 2:52006829-52006851 TGCAGCGCTTGCGGGCCAGCTGG + Intergenic
932521743 2:72421858-72421880 TGCAGCGCTTGCGGGCCAGCTGG + Intronic
936026001 2:109031619-109031641 TGCACCCCCTGCAGCTCGGCCGG + Intergenic
936093995 2:109517896-109517918 TGCACCTTCTGGGACCCTGCAGG - Intergenic
936094799 2:109523453-109523475 TGCACAGCCTGAGTCCCTGTGGG - Intergenic
937321793 2:120965432-120965454 TGCACCACCTGCATCCCGGCTGG - Intronic
937746567 2:125422276-125422298 TGCAGCGCTTGCGGGCCAGCTGG + Intergenic
938137457 2:128770776-128770798 TGCACCTCCTGCCCTCCTGCAGG - Intergenic
939972569 2:148678718-148678740 TGCAGCGCTTGCGGGCCAGCTGG - Intronic
942540153 2:177007882-177007904 TGCAGCGCTTGCGGGCCAGCTGG + Intergenic
944496580 2:200313191-200313213 AGCAACGCCTGTGGCTCTGCAGG + Intronic
946314144 2:218898287-218898309 TCCTCCGCCTGCGGGTCTGCAGG + Intronic
948575014 2:238944201-238944223 TCCTCCCCCTGCAGCCCTGCAGG - Intergenic
948933653 2:241149066-241149088 TTCACCGCAGCCGGCCCTGCGGG - Intronic
1171964160 20:31516746-31516768 TCCACACCCTGCTGCCCTGCAGG - Intronic
1171982465 20:31637777-31637799 CGCACAGCCTGCGTCCCTGGGGG - Intergenic
1172777394 20:37415459-37415481 TGCACGGGCTGCTGCACTGCAGG - Intergenic
1173919187 20:46731232-46731254 TGCACCTCCTTAGGCCATGCAGG - Intronic
1174068074 20:47879855-47879877 TGCACACCCTGTGGCTCTGCAGG + Intergenic
1177454868 21:21324455-21324477 TGGAGAGCCTGAGGCCCTGCAGG - Exonic
1178983385 21:37283516-37283538 TGCGGCGCCTGCGGGCCAGCTGG - Intergenic
1179799516 21:43804420-43804442 TGCGCAGCCTGCGGACCCGCGGG - Exonic
1180174363 21:46080528-46080550 TGCACCGCCCTGGGCCCTGCAGG - Intergenic
1180188705 21:46152717-46152739 AGCCTCGCCTGCGGCCGTGCAGG - Intronic
1184474489 22:44713146-44713168 GGCACAGCCTGAGGTCCTGCAGG - Intronic
1185147050 22:49143284-49143306 TGCATCGCTTGCAGCCCTTCTGG - Intergenic
950297943 3:11848108-11848130 TGAGCTGCCTGCTGCCCTGCAGG + Intergenic
954304658 3:49719226-49719248 TCCAGCGCCTGCGCCCCGGCTGG - Exonic
965092314 3:164179656-164179678 AGCTCTGCCTGCGGCCCTGATGG + Intergenic
967852900 3:194095558-194095580 TGCTCCTCCTGGGGCACTGCTGG - Intergenic
968188965 3:196653593-196653615 TGCACTCACTGCTGCCCTGCTGG - Intronic
968448805 4:665618-665640 TGCATGGCTCGCGGCCCTGCTGG - Intronic
969105548 4:4804751-4804773 TGCACCGCCTTCAGCTGTGCTGG + Intergenic
972022815 4:34335971-34335993 TGCAGCGCTTGCGGGCCAGCTGG - Intergenic
978620418 4:110631164-110631186 TACACCGCCAGTCGCCCTGCTGG - Intronic
982408195 4:155044334-155044356 TGCAGCGCTTGCGGGCCAGCTGG + Intergenic
985668739 5:1195643-1195665 TGCACGGCCTCTGACCCTGCAGG - Intergenic
985838986 5:2291491-2291513 TGCAGCTCCTTCAGCCCTGCAGG - Intergenic
986151970 5:5137816-5137838 TGCAGCGCTTGCGGGCCAGCTGG + Intergenic
986176963 5:5360546-5360568 CGCACCGGCTGCCTCCCTGCAGG - Intergenic
986288469 5:6378518-6378540 GGCCACGCCTGCGGCGCTGCTGG - Exonic
986697965 5:10375189-10375211 TGCAGCGCTTGCGGGCCAGCTGG + Intronic
987315264 5:16717982-16718004 TGCAGCGCTTGCGGGCCAGCTGG + Intronic
988132126 5:27119928-27119950 TGCAGCGCTTGCGGGCCAGCTGG + Intronic
993031835 5:82714711-82714733 TGCAGCGCTTGCGGGCCAGCTGG + Intergenic
995568646 5:113457175-113457197 TGCAGCGCTTGCGGGCCAGCTGG + Intronic
1003172727 6:3732971-3732993 TGCATGGACTGTGGCCCTGCAGG - Intronic
1007842544 6:44728479-44728501 TGCACCGGCTCCGCACCTGCAGG - Intergenic
1011281215 6:85679319-85679341 TGCCCGCCCTGAGGCCCTGCAGG - Intergenic
1013081517 6:106817091-106817113 TGCAGCGCTTGCGGGCCAGCTGG - Intergenic
1013143599 6:107364574-107364596 TGCAGCGCTTGCGGGCCAGCTGG - Intronic
1013728850 6:113137673-113137695 TGCAGCCCATGCGGCCCTCCTGG - Intergenic
1015043029 6:128744546-128744568 TGCAAGGCCTGAGTCCCTGCTGG + Intergenic
1018911211 6:168101625-168101647 TGCACGGCCCGCGCTCCTGCCGG - Intergenic
1019624284 7:2008237-2008259 TGCGCTGTCTGAGGCCCTGCGGG - Intronic
1022286421 7:28958644-28958666 TTCTCCGCCTGCGTCCCCGCGGG - Intergenic
1022667828 7:32428243-32428265 TGCTCCGCCTCTGACCCTGCGGG + Intergenic
1024224365 7:47314448-47314470 TGCACCTCCCCCAGCCCTGCCGG - Intronic
1026511895 7:71034298-71034320 TACACCACCTGAGGCCCTCCTGG - Intergenic
1028988743 7:97027471-97027493 TGCACTGCCGGCTGCTCTGCGGG + Intergenic
1034269806 7:149798019-149798041 TGCACAGCCCCCGGCCCTGAGGG - Intergenic
1035557805 8:579525-579547 TGCACTGCCTGAGGCCCGTCAGG + Intergenic
1035588274 8:793840-793862 TGCACTTCCTGTGGCCATGCTGG + Intergenic
1039965475 8:42280722-42280744 AGCGCTGCCTGGGGCCCTGCGGG + Intronic
1041304938 8:56448213-56448235 AGCACCGCCTGCCTCCCGGCCGG + Intergenic
1042137434 8:65645229-65645251 TGCACCGCCAGCCGGCCTCCGGG + Intronic
1048321467 8:133403754-133403776 TGCACCGCCCCCAGCCCAGCAGG - Intergenic
1049109423 8:140634415-140634437 TGCGCCGCCTGCGGCCCGGCTGG + Intronic
1049387759 8:142353005-142353027 TGCCCTGCCTAAGGCCCTGCAGG + Intronic
1049442181 8:142614583-142614605 CGCCCCGCCCGCGCCCCTGCAGG + Intergenic
1049493467 8:142917124-142917146 TGGACAGCCTGCATCCCTGCAGG - Exonic
1049500279 8:142959508-142959530 TGCAGCGCTTGCGGGCCAGCTGG + Intergenic
1049756734 8:144314118-144314140 TGCACCAGCTGCTTCCCTGCGGG - Exonic
1051439827 9:17072636-17072658 TGCAGCGCTTGCGGGCCAGCTGG + Intergenic
1051780562 9:20684353-20684375 CGCGCCGCCTGCGGCCCGGTCGG + Intronic
1053161190 9:35814623-35814645 TCCACTGCCTGCAGCCCAGCTGG - Intronic
1056515616 9:87346417-87346439 TGCACCGTCTGGGGACATGCAGG - Intergenic
1057025739 9:91732941-91732963 GGCCCCGCCTGCTGCCCTGCTGG + Intronic
1057183228 9:93040875-93040897 TGCACCTCCTGTGGCCCAGCTGG - Intergenic
1059405814 9:114098039-114098061 TGCGCCGCCTGCGGCTCCCCAGG + Intronic
1061484457 9:130913289-130913311 GGCAGCGCCCGCGGCCCGGCCGG + Intronic
1061879597 9:133562202-133562224 CGCACCCTCTGCAGCCCTGCTGG + Intronic
1062174585 9:135153836-135153858 TGTCCTGCCTGCGTCCCTGCTGG - Intergenic
1062421532 9:136484676-136484698 TGCACCGCCTGCGGCCCTGCTGG - Exonic
1185615197 X:1417990-1418012 TGCACTGCCTGCGGTCCGGGGGG + Exonic
1185736635 X:2500889-2500911 TGCGGCGCGGGCGGCCCTGCGGG - Exonic
1186785767 X:12954917-12954939 TGAACTCCCTGAGGCCCTGCTGG - Intergenic
1200150567 X:153949429-153949451 TGCACCACTGGAGGCCCTGCTGG + Intronic
1201715769 Y:17043137-17043159 TGCAGCGCTTGCGGGCCAGCTGG + Intergenic