ID: 1062424192

View in Genome Browser
Species Human (GRCh38)
Location 9:136498455-136498477
Sequence AGCTGCCGCCACGCGTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062424186_1062424192 -8 Left 1062424186 9:136498440-136498462 CCCCGCCCCGCAGGGAGCTGCCG 0: 1
1: 0
2: 0
3: 30
4: 476
Right 1062424192 9:136498455-136498477 AGCTGCCGCCACGCGTGTTCTGG No data
1062424180_1062424192 20 Left 1062424180 9:136498412-136498434 CCTTGGCCTTGGTGAACACACCA 0: 1
1: 0
2: 2
3: 13
4: 176
Right 1062424192 9:136498455-136498477 AGCTGCCGCCACGCGTGTTCTGG No data
1062424179_1062424192 29 Left 1062424179 9:136498403-136498425 CCTTGAGGTCCTTGGCCTTGGTG 0: 1
1: 0
2: 5
3: 19
4: 216
Right 1062424192 9:136498455-136498477 AGCTGCCGCCACGCGTGTTCTGG No data
1062424187_1062424192 -9 Left 1062424187 9:136498441-136498463 CCCGCCCCGCAGGGAGCTGCCGC 0: 1
1: 0
2: 2
3: 35
4: 338
Right 1062424192 9:136498455-136498477 AGCTGCCGCCACGCGTGTTCTGG No data
1062424182_1062424192 14 Left 1062424182 9:136498418-136498440 CCTTGGTGAACACACCAAGAGGC 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1062424192 9:136498455-136498477 AGCTGCCGCCACGCGTGTTCTGG No data
1062424184_1062424192 0 Left 1062424184 9:136498432-136498454 CCAAGAGGCCCCGCCCCGCAGGG 0: 1
1: 1
2: 2
3: 29
4: 279
Right 1062424192 9:136498455-136498477 AGCTGCCGCCACGCGTGTTCTGG No data
1062424188_1062424192 -10 Left 1062424188 9:136498442-136498464 CCGCCCCGCAGGGAGCTGCCGCC 0: 1
1: 0
2: 3
3: 21
4: 307
Right 1062424192 9:136498455-136498477 AGCTGCCGCCACGCGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062424192 Original CRISPR AGCTGCCGCCACGCGTGTTC TGG Intronic
No off target data available for this crispr