ID: 1062424367

View in Genome Browser
Species Human (GRCh38)
Location 9:136499210-136499232
Sequence CTGGATGCCCGCATGCATGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 88}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062424367_1062424378 17 Left 1062424367 9:136499210-136499232 CCATCATGCATGCGGGCATCCAG 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1062424378 9:136499250-136499272 GGATCAGGATCTGGGCAACAGGG 0: 1
1: 0
2: 2
3: 13
4: 220
1062424367_1062424380 28 Left 1062424367 9:136499210-136499232 CCATCATGCATGCGGGCATCCAG 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1062424380 9:136499261-136499283 TGGGCAACAGGGAGAGGCTCAGG 0: 1
1: 0
2: 23
3: 258
4: 974
1062424367_1062424377 16 Left 1062424367 9:136499210-136499232 CCATCATGCATGCGGGCATCCAG 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1062424377 9:136499249-136499271 CGGATCAGGATCTGGGCAACAGG 0: 1
1: 0
2: 0
3: 6
4: 69
1062424367_1062424372 -4 Left 1062424367 9:136499210-136499232 CCATCATGCATGCGGGCATCCAG 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1062424372 9:136499229-136499251 CCAGGTCTGTGGCTCGGTTCCGG 0: 1
1: 0
2: 1
3: 14
4: 146
1062424367_1062424370 -10 Left 1062424367 9:136499210-136499232 CCATCATGCATGCGGGCATCCAG 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1062424370 9:136499223-136499245 GGGCATCCAGGTCTGTGGCTCGG 0: 1
1: 0
2: 0
3: 19
4: 242
1062424367_1062424375 9 Left 1062424367 9:136499210-136499232 CCATCATGCATGCGGGCATCCAG 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1062424375 9:136499242-136499264 TCGGTTCCGGATCAGGATCTGGG 0: 1
1: 0
2: 0
3: 2
4: 24
1062424367_1062424373 2 Left 1062424367 9:136499210-136499232 CCATCATGCATGCGGGCATCCAG 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1062424373 9:136499235-136499257 CTGTGGCTCGGTTCCGGATCAGG 0: 1
1: 0
2: 0
3: 3
4: 47
1062424367_1062424374 8 Left 1062424367 9:136499210-136499232 CCATCATGCATGCGGGCATCCAG 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1062424374 9:136499241-136499263 CTCGGTTCCGGATCAGGATCTGG 0: 1
1: 0
2: 0
3: 2
4: 31
1062424367_1062424379 22 Left 1062424367 9:136499210-136499232 CCATCATGCATGCGGGCATCCAG 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1062424379 9:136499255-136499277 AGGATCTGGGCAACAGGGAGAGG 0: 1
1: 0
2: 2
3: 109
4: 2085

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062424367 Original CRISPR CTGGATGCCCGCATGCATGA TGG (reversed) Exonic
900953046 1:5869260-5869282 ATGGATGCATGCATGCATGTGGG - Intronic
904296237 1:29521436-29521458 CTGGATGCCACCATCCAGGATGG + Intergenic
904410094 1:30320010-30320032 CTGGATGCCACCATCCAGGATGG - Intergenic
913551204 1:119918504-119918526 CTAGATGCCAGGATGAATGATGG - Exonic
918309005 1:183272238-183272260 CTGGATGCCTGCATTGATGCTGG + Intronic
922812429 1:228424948-228424970 CTGGATGTCCTTAGGCATGATGG + Exonic
924827473 1:247555947-247555969 ATGGATGCCCACATGCAGCAGGG + Intronic
924955678 1:248924273-248924295 CTGGAAGCCAGCAGTCATGAAGG - Intergenic
1063703285 10:8406627-8406649 CAGGATGCCATCATGCTTGATGG + Intergenic
1074048202 10:109858490-109858512 CTTGAGCCCCGCATGCATTAGGG + Intergenic
1074668737 10:115762343-115762365 TTGGATGACCTCATCCATGATGG + Intronic
1075585143 10:123651928-123651950 CAGGATGCCCACATGCCTGCAGG - Intergenic
1077593059 11:3507859-3507881 CTTGGTGCCAGCATGCAAGAGGG - Intergenic
1078131631 11:8618774-8618796 TTGGATGCCCTCCTGCATGTAGG + Exonic
1080100683 11:28456040-28456062 CTGCATGCCAGCCGGCATGATGG - Intergenic
1084248894 11:67880579-67880601 CTTGGTGCCAGCATGCATGAGGG - Intergenic
1088627108 11:111737393-111737415 CTGGCTGCCCGCAGCCCTGAGGG + Intronic
1088645083 11:111911549-111911571 CTGGGTGCCCGCAGGAAGGAGGG + Exonic
1091872486 12:3906116-3906138 ATGGATGACTGCAAGCATGAGGG - Intergenic
1099459871 12:82909316-82909338 CTGGAGTCCTGCATTCATGAAGG + Intronic
1101801062 12:108022281-108022303 TTGGATGCATGCATGGATGATGG - Intergenic
1102614163 12:114138557-114138579 CTGGGTGCCGGCAAGCATGGGGG + Intergenic
1104024532 12:125016108-125016130 CTGAATGCCTGCATTCATCAGGG + Intronic
1104029949 12:125057826-125057848 GTGGATTTCCACATGCATGAGGG + Intergenic
1104968084 12:132518515-132518537 ATGGATGCATGCATGCATGGTGG - Intronic
1106610140 13:31271075-31271097 CTGGAGGCCCACATGCATGGAGG - Intronic
1107483728 13:40806761-40806783 CTGGTTGCCCTCAATCATGAAGG + Intronic
1109604012 13:64668156-64668178 ATGGGTGCCAGCATCCATGAAGG - Intergenic
1111343539 13:86919092-86919114 ATGGAAGCCTGCATGCGTGAAGG - Intergenic
1119294583 14:73522636-73522658 CTGGATGCATGCAGGGATGATGG + Exonic
1120157815 14:81113387-81113409 CTGCCTGCCTGCATGCATCATGG - Intronic
1121334230 14:93067320-93067342 CTGGAAGCCTGCCTGCAAGAAGG + Intronic
1124365740 15:29070335-29070357 CTGGATACCGGGATGCAGGAGGG + Intronic
1127969641 15:63948232-63948254 CTGCATTCCAGCCTGCATGATGG + Intronic
1131118433 15:89808500-89808522 GTGGATGCGCACATGCACGAAGG + Intronic
1131862725 15:96671457-96671479 CTGGATGTCCTCATTTATGAAGG - Intergenic
1131893748 15:97003521-97003543 CTGGTTTTCCACATGCATGAAGG + Intergenic
1146910206 17:36643576-36643598 CTGGATGCCAGAAAGCCTGAGGG - Intergenic
1147324567 17:39664020-39664042 CTGGAAGCCTGCATGCAGGCAGG - Intergenic
1151342002 17:73477552-73477574 CTGGATGCCCACATCAAAGATGG - Intronic
1152586272 17:81190842-81190864 CTGGCTGCGTGCATGCAGGAGGG + Intronic
1162475324 19:10896216-10896238 CTGGGTCCCAGCATGCAGGAGGG - Intronic
1163050796 19:14682271-14682293 ATGGATGCATGGATGCATGATGG - Intronic
1163111732 19:15165466-15165488 TTGGATGCCCGCATGGCAGATGG - Exonic
1164400644 19:27899973-27899995 CTGGATGGCCACGTGAATGAAGG - Intergenic
1166349202 19:42186830-42186852 TTGGATGCCCGGATGGATGGAGG + Intronic
1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG + Exonic
1167045169 19:47045443-47045465 CAGGAAGCCCGCGTGCAGGAGGG - Exonic
1167664282 19:50814564-50814586 CTGGATCCACCCATGCCTGAAGG - Intergenic
931390779 2:61841934-61841956 CTGGATGACCGTTTGCTTGAGGG - Intronic
932334214 2:70920620-70920642 GTGCATGCATGCATGCATGAAGG - Intronic
935600998 2:104921243-104921265 CTGGATGCTCATGTGCATGAAGG + Intergenic
935812648 2:106814679-106814701 CTGGATGCCCTACTGCATGCAGG + Intronic
941728878 2:168893535-168893557 CTGACTGCCAACATGCATGAAGG + Intronic
945561815 2:211349025-211349047 CTGGATGCTCCCTTGCATAAGGG + Intergenic
1174304094 20:49602968-49602990 CTGGATGACCCCTTGCAGGAAGG - Intergenic
1175752754 20:61510455-61510477 CGGAATGCCCGCATGCCTGCTGG + Intronic
1180501961 22:15937863-15937885 GAGGATGCCCCCTTGCATGAAGG - Intergenic
1180588935 22:16919351-16919373 CTGGGTCCCCGCCTCCATGAGGG + Intergenic
1184172592 22:42768732-42768754 CTGCAGCCCCGCATGCCTGAGGG - Intergenic
1184570165 22:45317962-45317984 GTGGCTGCCAGCAGGCATGAGGG + Intronic
952185419 3:30962706-30962728 CTGGAAGCTCGCAATCATGATGG + Intergenic
953929611 3:46999399-46999421 CTGGTTGCCTGCTTGCCTGAGGG + Exonic
953993852 3:47504502-47504524 CTAGATGCCAGCTTGCAAGAGGG + Intronic
956737392 3:72248200-72248222 CTGGAAGGCAGCCTGCATGATGG + Intergenic
968235342 3:197027813-197027835 CTGGATGCCCGCTTCCCGGAAGG + Exonic
970356511 4:15258994-15259016 CTGTATGCACAAATGCATGAAGG - Intergenic
971311063 4:25526073-25526095 CAGGCTGCCCGCAGGCAGGAAGG - Intergenic
975719560 4:77236597-77236619 CTGGATGCCCACAGGCAGGCAGG - Intronic
977734598 4:100398626-100398648 CTGGGTGCCTGAATGCATCATGG - Intronic
978085046 4:104641497-104641519 ATGGCTGCCTGCATGCATCACGG + Intergenic
985138373 4:186812450-186812472 CTGGAATGCCACATGCATGATGG + Intergenic
998493468 5:142566760-142566782 CTGACCGCCCTCATGCATGATGG + Intergenic
1009493180 6:64316999-64317021 CTGGCTGCCCATATGCAGGAAGG + Intronic
1012209770 6:96505571-96505593 CTGAATGCCAGCCTTCATGAAGG + Intergenic
1019895321 7:3977852-3977874 CTGCCTGCGTGCATGCATGAAGG + Intronic
1022839669 7:34151094-34151116 CTGGAGTCCACCATGCATGAGGG + Intronic
1024295584 7:47839498-47839520 CTGTCTGCCGGCAGGCATGATGG - Exonic
1035288651 7:157822849-157822871 ATGGATGCCTGCATGGATGATGG - Intronic
1036150946 8:6297799-6297821 CAGTATGCCTGCATGAATGAAGG + Intergenic
1038397025 8:27254413-27254435 CTGGATGGCCTGATTCATGATGG - Intronic
1039411146 8:37356291-37356313 ATGGATGCATGCATGCATGTTGG + Intergenic
1048872563 8:138811716-138811738 CTGAAAGGCCACATGCATGATGG + Intronic
1049420202 8:142513092-142513114 CAGGATGCCAGCAGGCATGTTGG + Intronic
1054361766 9:64128799-64128821 CTGGAGGCCCACATGCACTAGGG - Intergenic
1056849877 9:90073489-90073511 CTGGAAGCCCCCTTGCTTGATGG + Intergenic
1060015396 9:120082192-120082214 ATGGATACCTGCATGGATGAAGG - Intergenic
1062266708 9:135689823-135689845 CTGGATGCCTGTCTGCCTGAGGG - Intergenic
1062424367 9:136499210-136499232 CTGGATGCCCGCATGCATGATGG - Exonic
1186936034 X:14450740-14450762 CTGCATTCCAGCATGGATGATGG - Intergenic
1193934615 X:87601363-87601385 CAGGTTGCCCACATGCATGGTGG + Intronic
1195258861 X:103114003-103114025 CTCGATGCCCTCGTACATGATGG - Intergenic