ID: 1062424538

View in Genome Browser
Species Human (GRCh38)
Location 9:136500024-136500046
Sequence CTGCAAAGGCAGCCCCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062424536_1062424538 1 Left 1062424536 9:136500000-136500022 CCTGGGGACTCGCAGCAGGGGTG 0: 1
1: 0
2: 0
3: 21
4: 205
Right 1062424538 9:136500024-136500046 CTGCAAAGGCAGCCCCTGCCAGG No data
1062424525_1062424538 27 Left 1062424525 9:136499974-136499996 CCTGCTTGCTCCAGGGCCGCCTG 0: 1
1: 0
2: 3
3: 28
4: 262
Right 1062424538 9:136500024-136500046 CTGCAAAGGCAGCCCCTGCCAGG No data
1062424532_1062424538 8 Left 1062424532 9:136499993-136500015 CCTGGAGCCTGGGGACTCGCAGC 0: 1
1: 0
2: 1
3: 31
4: 250
Right 1062424538 9:136500024-136500046 CTGCAAAGGCAGCCCCTGCCAGG No data
1062424531_1062424538 11 Left 1062424531 9:136499990-136500012 CCGCCTGGAGCCTGGGGACTCGC 0: 1
1: 0
2: 2
3: 21
4: 248
Right 1062424538 9:136500024-136500046 CTGCAAAGGCAGCCCCTGCCAGG No data
1062424529_1062424538 17 Left 1062424529 9:136499984-136500006 CCAGGGCCGCCTGGAGCCTGGGG 0: 1
1: 0
2: 8
3: 86
4: 698
Right 1062424538 9:136500024-136500046 CTGCAAAGGCAGCCCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062424538 Original CRISPR CTGCAAAGGCAGCCCCTGCC AGG Intronic
No off target data available for this crispr