ID: 1062424940

View in Genome Browser
Species Human (GRCh38)
Location 9:136501844-136501866
Sequence GGTGCTGCTGAGTCCACTGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062424936_1062424940 10 Left 1062424936 9:136501811-136501833 CCATGGCAGACATGCGCAGGTCA 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1062424940 9:136501844-136501866 GGTGCTGCTGAGTCCACTGCCGG 0: 1
1: 0
2: 3
3: 21
4: 268
1062424933_1062424940 28 Left 1062424933 9:136501793-136501815 CCTGGGGCGGTGTGGGGGCCATG 0: 1
1: 0
2: 5
3: 30
4: 260
Right 1062424940 9:136501844-136501866 GGTGCTGCTGAGTCCACTGCCGG 0: 1
1: 0
2: 3
3: 21
4: 268
1062424932_1062424940 29 Left 1062424932 9:136501792-136501814 CCCTGGGGCGGTGTGGGGGCCAT 0: 1
1: 0
2: 0
3: 16
4: 150
Right 1062424940 9:136501844-136501866 GGTGCTGCTGAGTCCACTGCCGG 0: 1
1: 0
2: 3
3: 21
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062424940 Original CRISPR GGTGCTGCTGAGTCCACTGC CGG Exonic
900959015 1:5907550-5907572 GGAGGTGCTCAGTCCAGTGCTGG - Intronic
903258787 1:22120089-22120111 GGTGCTGCTTCGTCAAGTGCCGG - Exonic
904238370 1:29128329-29128351 GTTGCTGCTGAGTCGTCCGCTGG + Intergenic
904337098 1:29805057-29805079 GCTGCTGCTGTGCCCACTGTAGG + Intergenic
906242768 1:44252138-44252160 GGTGCTCCTGAGTCCTGTCCAGG + Intronic
906514107 1:46428919-46428941 GTGGCTGCTGAGACCACAGCAGG - Intergenic
910991479 1:93061116-93061138 GGTAGTTCTCAGTCCACTGCGGG - Intergenic
912264983 1:108148420-108148442 GGTGCAGCTCAGTCCACAGCAGG - Intronic
914318965 1:146541151-146541173 TGAGCTGCTAAGTCCACTTCTGG - Intergenic
914427759 1:147594080-147594102 GGTTCTGCTGAGCCCAATGAGGG - Intronic
914495392 1:148192206-148192228 TGAGCTGCTAAGTCCACTTCTGG + Intergenic
916212773 1:162372304-162372326 TGTGCTGCTCAGTACAGTGCTGG + Intronic
916329571 1:163599625-163599647 GGGGAGGCTGACTCCACTGCAGG - Intergenic
920003153 1:202812821-202812843 GGTGCTGGTGGTGCCACTGCGGG - Intergenic
922082277 1:222308767-222308789 GGTGCCACTGAATCCACTGGGGG - Intergenic
922234419 1:223712534-223712556 CGCGCTGCTGCGGCCACTGCGGG - Exonic
922797693 1:228349120-228349142 TGGGCTGCTGTGTCCTCTGCAGG + Intronic
1062930384 10:1348767-1348789 GCTGCTGCTGAGGCCAACGCTGG + Intronic
1063425666 10:5948306-5948328 AGAGCTTCTGAGGCCACTGCTGG + Intronic
1063766827 10:9151318-9151340 TGTCCTGCTGAGTCTGCTGCAGG - Intergenic
1065207908 10:23374591-23374613 GGTTGGGCTGAGTCCACTTCTGG + Intergenic
1066532429 10:36355273-36355295 GGTGATTCTGAATCCCCTGCAGG + Intergenic
1070773722 10:79097866-79097888 AGTGCTGCTGAGGCCTCTCCAGG - Intronic
1073147049 10:101287986-101288008 GGGGCTGCTGGGTCCACTTCGGG - Intergenic
1075701803 10:124474772-124474794 GGCGCTGCTGTAGCCACTGCTGG + Intronic
1075771073 10:124936404-124936426 GGTGATTCTGAGTTCTCTGCTGG + Intergenic
1076126548 10:127978620-127978642 GGGGCTGCTGAACCCACTCCTGG - Intronic
1076183595 10:128429968-128429990 GCTGCTGCTGAGTACAGAGCTGG + Intergenic
1076238982 10:128888030-128888052 TGGGCTGCAGAGGCCACTGCTGG + Intergenic
1076765983 10:132633466-132633488 GGCTCTGGTGAGGCCACTGCAGG + Intronic
1077390308 11:2297838-2297860 GGTGCTGCTGATTCCAGTCTTGG + Exonic
1077473804 11:2777068-2777090 GGTGCGGGAGAGTCCATTGCAGG - Intronic
1077533826 11:3109645-3109667 GATCCTGCTGGTTCCACTGCAGG + Intronic
1077905501 11:6529784-6529806 GGTGCTGCTGTGTCCTGGGCTGG + Intronic
1077910163 11:6566311-6566333 GGAGCAGCTGAGTCCACCCCAGG + Exonic
1078194230 11:9121618-9121640 GGGGCTGCTGAGCCCAGTGTGGG + Intronic
1078451869 11:11446537-11446559 GGAGCTGCAGAGACCACTCCTGG - Intronic
1079135767 11:17775304-17775326 GGTGCTGCTGGCACCACTGGGGG - Intronic
1079763200 11:24356688-24356710 GCTGGTGCTGTATCCACTGCTGG - Intergenic
1080871660 11:36241886-36241908 GACTCTGCAGAGTCCACTGCTGG + Intergenic
1083315480 11:61812470-61812492 GGTGCTGCTCAGTGCAGTTCAGG - Exonic
1084648730 11:70475683-70475705 GGGGCTGGTGGGTGCACTGCTGG + Intronic
1085299469 11:75449884-75449906 GGTGCTGCTGATCTCCCTGCAGG - Exonic
1087785910 11:102353979-102354001 GGTTCTGCAGAGTCAACTTCTGG - Intronic
1089789485 11:120932397-120932419 GGGGCTGCTGAGCTCACTGGGGG - Intronic
1090073532 11:123564222-123564244 GGTGATGCTGAGTTAACTGTGGG + Intronic
1091679347 12:2515661-2515683 GGTGGGGCTGAGTGCAGTGCAGG + Intronic
1091755194 12:3046776-3046798 GGTGCCCCTGCGTCCACTACAGG + Intergenic
1092169352 12:6363568-6363590 GGTGCGGCAGAGTCCCCCGCAGG + Exonic
1095489360 12:42717025-42717047 AGTGCTGCAGTGGCCACTGCTGG + Intergenic
1096231880 12:49901234-49901256 GGTGGGGCTGAGGGCACTGCTGG + Exonic
1096997147 12:55845635-55845657 GTTCCTGCTTAGTCCCCTGCGGG + Intergenic
1099712922 12:86250011-86250033 GGTGGTGCTCTGTTCACTGCTGG + Intronic
1101102096 12:101404440-101404462 TGTGCTGCTCTGTGCACTGCAGG + Intronic
1101295780 12:103422507-103422529 AGTGGTTCTGAGTCCCCTGCTGG + Intronic
1105018639 12:132801823-132801845 GCTGCTGCTGGTACCACTGCCGG + Exonic
1113077159 13:106478265-106478287 GGTGTTGCTGAGTCCACTTCTGG - Intergenic
1113292869 13:108925341-108925363 TGTGCTGCTGAGCACATTGCAGG + Intronic
1113757440 13:112822974-112822996 GGTGCTGCTGACGGCACTGGTGG + Intronic
1114674594 14:24431825-24431847 GGAGCTGCTGAGTCTGGTGCAGG + Exonic
1115798525 14:36966465-36966487 GGATGTGCTGAGTCCACTCCAGG - Intronic
1117674108 14:58138628-58138650 CCTGGTGCTGAGTCCACAGCAGG - Exonic
1118922018 14:70158101-70158123 GGTGCTGCAGAGGCTAATGCTGG - Intronic
1119618854 14:76116710-76116732 GATGCTGCTGAGGCCTCTTCAGG - Intergenic
1121280180 14:92692310-92692332 AGTGCTGAGGAGTCCACAGCTGG + Intergenic
1124115853 15:26842655-26842677 GGGGCTGCTGAGTACCCAGCTGG + Intronic
1124115881 15:26842743-26842765 GGGGCTGCTGAGTACCCAGCTGG + Intronic
1124115896 15:26842787-26842809 GGGGCTGCTGAGTACCCAGCTGG + Intronic
1124345428 15:28918687-28918709 GGGGCTGCAGAGGCTACTGCTGG + Intronic
1125503589 15:40253802-40253824 GGTGCTGCTGGGAGCACTGGAGG + Intronic
1127691527 15:61402052-61402074 TGTGCTGCTGGCACCACTGCTGG + Intergenic
1132333794 15:101030308-101030330 GGGCCTGCTGAGGACACTGCGGG - Intronic
1132653388 16:1031499-1031521 GATGCTGCTGAGACAACTTCAGG + Intergenic
1132912920 16:2324831-2324853 CGGGCTGCAGAGCCCACTGCAGG - Intronic
1134504730 16:14795684-14795706 CGTGCTGCTGTGTTCAATGCTGG - Intronic
1134575843 16:15333225-15333247 CGTGCTGCTGTGTTCAATGCTGG + Intergenic
1134726601 16:16423276-16423298 CGTGCTGCTGTGTTCAATGCTGG - Intergenic
1134940832 16:18288583-18288605 CGTGCTGCTGTGTTCAATGCTGG + Intergenic
1135987332 16:27193605-27193627 TGTCCTGCTGACCCCACTGCAGG - Intergenic
1136394827 16:29987182-29987204 GCTGCTGCTGCTTCCATTGCTGG + Exonic
1139598041 16:67969207-67969229 GGGGCTGCTGCGTCCTCCGCAGG + Intronic
1140665941 16:77227728-77227750 GTGGCTGCTGATTCTACTGCTGG - Intergenic
1141311798 16:82920600-82920622 GGTGAGGCTGTCTCCACTGCAGG + Intronic
1141505024 16:84471345-84471367 GGTGCTGCTGAGCCCCAGGCTGG - Intergenic
1141536770 16:84686910-84686932 GGTGATGCTGTGTCAACTCCAGG - Intergenic
1141551673 16:84810534-84810556 GGTACTGCTGAGTCCTCGCCAGG + Intergenic
1141558119 16:84849317-84849339 GCTGCTGCTGTCTCCACTGGTGG + Intronic
1141919608 16:87127233-87127255 GAGGCTGCTGGGTCCCCTGCCGG - Intronic
1141938080 16:87255242-87255264 GGGGCTGCTGTGGTCACTGCTGG + Intronic
1142200894 16:88760701-88760723 GGTGCTGCTGCGTCAAAGGCGGG - Intronic
1142497493 17:314147-314169 TGTGCTGCAGAGGCCGCTGCTGG - Intronic
1142639869 17:1279705-1279727 GGTGCTGCTGAGAGCACAGATGG - Exonic
1144584751 17:16481508-16481530 TGTCATGCTGAGTCCACTGTAGG + Intronic
1145268941 17:21393923-21393945 GGTGCCACTGAGGGCACTGCTGG + Intronic
1146516986 17:33497078-33497100 GGTACTGCTTAGGCCATTGCTGG + Intronic
1149003116 17:51777457-51777479 AGTTCTGCTGAGCCCACTACAGG + Intronic
1149494200 17:57106737-57106759 GGTGGTGGTGAGCCCTCTGCTGG - Exonic
1150294193 17:63999011-63999033 GCTGCTGCTGAGTCGCCTGGTGG + Exonic
1150623244 17:66823943-66823965 GGTGCTGCCCTGTTCACTGCAGG - Intergenic
1150821509 17:68438144-68438166 GGCTTTGCTGAGTCCACAGCAGG + Intronic
1151325804 17:73379277-73379299 GGTGCTGCTGTGGGCACTGGAGG + Exonic
1151675004 17:75592726-75592748 GGGGCTGCTGAAGGCACTGCAGG + Intergenic
1151705033 17:75762966-75762988 GGAGCTGCTGAGTGCAGGGCGGG + Intronic
1152224423 17:79086093-79086115 GTTGCTTCCGAATCCACTGCTGG + Exonic
1152455628 17:80414671-80414693 AGTGCTCCTGAGGCAACTGCCGG + Intergenic
1152754331 17:82080863-82080885 GGTTCAGCTGAGTCTGCTGCTGG + Exonic
1152801475 17:82332803-82332825 GCTGCTGCTGAGCCCAGAGCGGG - Intronic
1154492786 18:14934147-14934169 AGGTCTGCTGACTCCACTGCAGG + Intergenic
1154502383 18:15003296-15003318 GGCGCAGCTGAGGCCACTGTGGG + Intergenic
1156678851 18:39565406-39565428 GTTGCTGCTGACTTCACTGTTGG - Intergenic
1157619382 18:49007333-49007355 GGTTCTGCAAACTCCACTGCAGG - Intergenic
1159883497 18:73882268-73882290 GGGGCTGCTGTATCCCCTGCAGG + Intergenic
1159922102 18:74235903-74235925 GCTGCTGCCGAGACCACTGCTGG - Intergenic
1160659113 19:290260-290282 GGAGGTGCTGAGTCACCTGCCGG - Intronic
1160968500 19:1757150-1757172 GGTGCTGCTGACCCGGCTGCGGG - Intronic
1161159314 19:2753073-2753095 GTTGCTGCTTAGCACACTGCAGG - Intergenic
1162350588 19:10146567-10146589 GTAGCTGCTGCGGCCACTGCCGG - Intronic
1163112050 19:15167348-15167370 GATGGTGTTGAGTCCACTGACGG + Exonic
1163509700 19:17727343-17727365 GCTGTCGCTGAGCCCACTGCGGG + Exonic
1163644234 19:18479215-18479237 GATGCTGCTCAGCACACTGCAGG + Intronic
1166740378 19:45111098-45111120 AGCTCTGCTGAGTCCTCTGCCGG + Intronic
1166789862 19:45392272-45392294 GGGGCTGCTGACACCAGTGCTGG - Exonic
1167043630 19:47037592-47037614 GGTGCTGCAGATTACCCTGCCGG + Intronic
1167067623 19:47198751-47198773 GGTGCTTCAAAGACCACTGCTGG - Intronic
1167471695 19:49679303-49679325 GGGGCTCCTGAGTCCAAGGCAGG + Intronic
1167743503 19:51338173-51338195 GGTGCTGCTGCATCCGCTGGTGG - Exonic
925409073 2:3628419-3628441 GGTGCTGTTAAGACCAGTGCAGG - Intronic
926006842 2:9379077-9379099 GGTGCAGCTGAGCCCACCCCCGG - Intronic
927404721 2:22754225-22754247 GGTTCTGCTGAGTCCCTTGAGGG + Intergenic
933781203 2:85802620-85802642 GGTACTGCTGAGGCCTCTCCTGG - Intergenic
933987790 2:87606991-87607013 ATTGCTGCTGATGCCACTGCTGG - Intergenic
934568247 2:95352500-95352522 GGGGCTGCTAAGTCCAGTGCTGG - Intronic
935337939 2:102034448-102034470 GATCCTTCTGAGCCCACTGCAGG + Intergenic
935540435 2:104341556-104341578 AGTGGTGCTTAGTCCACGGCTGG + Intergenic
936038155 2:109129011-109129033 GGTCCTGCTGAATCCTCTGGAGG + Intergenic
936076347 2:109404136-109404158 GGTGTGGCCGAGACCACTGCAGG + Intronic
936306051 2:111343817-111343839 ATTGCTGCTGATGCCACTGCTGG + Intergenic
936671862 2:114665463-114665485 GAAGCTGCTGTGTCCATTGCAGG + Intronic
938017633 2:127880679-127880701 GGTGATGCCGAGTTCAGTGCTGG - Intronic
939628198 2:144504345-144504367 GGTGCTGCTGAGATCAGTACAGG + Intronic
941107156 2:161367496-161367518 TGTTCTGCTGTGTCCACTGCAGG - Exonic
943638547 2:190333547-190333569 GGTTCTGCTGAGTCAGCTGCTGG + Intronic
944513086 2:200483835-200483857 GGTGCAGCTGTGGCCACTGGAGG + Intergenic
946689416 2:222299148-222299170 GGTGGTGCCGAGGCCTCTGCTGG + Intronic
947653987 2:231810660-231810682 GCTGCTGCTGGGTCCAGTCCTGG + Intergenic
947951306 2:234149845-234149867 GGTAGTCCTGAGACCACTGCAGG + Intergenic
948379040 2:237540544-237540566 GGTCCTGCTGAGACCTCTGGGGG - Intronic
948481937 2:238255587-238255609 GTTGGTACTGAGTCCAGTGCTGG - Intronic
948810453 2:240472657-240472679 GCTGCTGCTGAGTCTACAGTGGG - Intergenic
1169038855 20:2476266-2476288 GGCGCTGCTGTGGGCACTGCTGG + Intronic
1169239136 20:3960134-3960156 GGTTCTGATGAGTCCAGTGGTGG + Intronic
1170422857 20:16209572-16209594 GGTGATGCTGAGCCCATTCCAGG - Intergenic
1172603377 20:36198526-36198548 GGGGCTTCGGAGTCCACTGGAGG + Intronic
1172707305 20:36891594-36891616 GGTGGTGCCCACTCCACTGCTGG + Exonic
1173594276 20:44248376-44248398 GGTGCCGCTTAGGCCCCTGCAGG - Intronic
1174545567 20:51322578-51322600 GCTCCTGCTGTGTCCTCTGCCGG + Intergenic
1175864972 20:62170682-62170704 GGGGCTGCTGAGATAACTGCAGG - Intronic
1176905296 21:14493165-14493187 GGGGCTGCTGTGACCACAGCTGG + Intronic
1177910741 21:27028297-27028319 GGTTCTGCAGGGTCCACTGGAGG - Intergenic
1178813526 21:35906145-35906167 GGGGCTGCTGAGTTCCCTGTGGG - Intronic
1179928507 21:44551588-44551610 GGCGTTGCTGAGTCTCCTGCTGG - Intronic
1180233084 21:46439463-46439485 GTTGCTGCTGACACCACTGCAGG - Intronic
1180234360 21:46448491-46448513 AGAGCTTCTGTGTCCACTGCAGG + Intergenic
1181365159 22:22370892-22370914 ATTGCTGCTGATTCCAGTGCAGG - Intergenic
1182006325 22:26962645-26962667 AGTGCTCCTGTGTCCACAGCAGG + Intergenic
1182303671 22:29353249-29353271 TGTGCTGCTGTGCACACTGCGGG + Intronic
1183814811 22:40290753-40290775 GGGCCTGCTGTGTTCACTGCTGG + Intronic
1183815171 22:40293741-40293763 GGGCCTGCTGTGTTCACTGCTGG + Intronic
1184640559 22:45867893-45867915 GGTGCTGCTGTTTCCAGAGCTGG - Intergenic
1184730507 22:46368804-46368826 GGTGTTGCTGAGGCCACTGGAGG - Intronic
1185136440 22:49076036-49076058 GATGCTGCTGCGGCCACAGCTGG - Intergenic
1185250353 22:49798617-49798639 GGTGCTGCTGCGCTCAGTGCTGG - Exonic
950032589 3:9862503-9862525 AGTGCGGCTGCGTCCCCTGCGGG - Intergenic
950579656 3:13853953-13853975 GGAGCAGCTGGGACCACTGCAGG + Intronic
953178645 3:40576032-40576054 GGTGCTGTTGACTCTTCTGCTGG + Intergenic
953346065 3:42176659-42176681 GGTGGTGGTGAGTACATTGCGGG + Intronic
953796892 3:45992796-45992818 GGGGCTGCAGAGTCAACTTCAGG + Intronic
954407444 3:50353351-50353373 GGCCCTGCTGTGTGCACTGCTGG + Exonic
956417861 3:69052100-69052122 GGTGCTGCCGCCGCCACTGCCGG - Exonic
961375405 3:126462159-126462181 TGGGCTGCTGAGTTCACTGCTGG + Exonic
961583493 3:127902715-127902737 GGAGCTGCTGAGGCGACTACTGG + Intergenic
962853190 3:139323236-139323258 GGTGCTGCAGAGGCCACAGGGGG - Intronic
964620494 3:158716088-158716110 GGTGTCGCTGACTCCTCTGCAGG - Intronic
965807008 3:172552128-172552150 GGGGTGGCTGAGGCCACTGCTGG + Intergenic
967875451 3:194265525-194265547 GGTGCTGCAGGCTGCACTGCCGG - Intergenic
968394662 4:223779-223801 GGTGCTGCTGGGTCTGCTGTGGG + Intergenic
968407011 4:349702-349724 GGTGCTGCTGGGTCTGCTGTGGG + Intronic
968446507 4:654979-655001 GGTGCTGCTGACTGCACCGTGGG - Intronic
968508285 4:982474-982496 GGTGCTGCTGGCCACACTGCTGG + Intronic
969342331 4:6550040-6550062 GGTGCAGCTGAGGTCACAGCGGG + Intronic
969676557 4:8617644-8617666 GTTGCTGCTGAGCCCCGTGCAGG + Intronic
975685095 4:76912895-76912917 GGTGCTCTTGAATCCACTACTGG - Intergenic
976788979 4:88856011-88856033 TGTGCTTGTGAGTCAACTGCAGG + Intronic
976906268 4:90240240-90240262 AGTCCTACTGAGTCCACTACAGG - Intronic
977132901 4:93265733-93265755 TGTGGTGGTGAGTCCACTGAAGG + Intronic
982032253 4:151312575-151312597 GGTCCTGGTGATGCCACTGCTGG - Intronic
985016719 4:185643640-185643662 GGCGACACTGAGTCCACTGCAGG + Intronic
985720187 5:1484847-1484869 GGTGCTGCTGAGCCCACAGCAGG - Intronic
985928657 5:3037174-3037196 GGGGCTGCAGAGTCCCCTGAGGG + Intergenic
987211824 5:15691560-15691582 GGTGCTGCTCAGTGTACTTCTGG + Intronic
990301764 5:54455949-54455971 TCTGCCGCTGAGTCCACTGGAGG - Exonic
990900480 5:60743908-60743930 TGTCCTGCTTGGTCCACTGCAGG + Intergenic
991429367 5:66528320-66528342 TGAGCTCCTGAGTCCATTGCTGG + Intergenic
993705708 5:91167565-91167587 CCAGTTGCTGAGTCCACTGCAGG - Intergenic
993781723 5:92074746-92074768 GTTTCTGCAGAGTCCACTGCAGG + Intergenic
994183605 5:96794943-96794965 GGGGCTGCTGAGGCAACTACAGG + Intronic
998393913 5:141806113-141806135 AGAGCTGGTGAGTCCTCTGCAGG - Intergenic
998563479 5:143194039-143194061 TGTCCTGCTGATTTCACTGCAGG - Intronic
999264132 5:150255486-150255508 GTAGCTGCTAAGTCCCCTGCAGG - Intronic
1001024313 5:168210699-168210721 GGTGTAGCTCAGTCCTCTGCCGG - Intronic
1002572083 5:180145814-180145836 GCTGCTGCTGGGACCTCTGCAGG + Intronic
1002704267 5:181149470-181149492 GGGGATGCTGAGTACACAGCGGG + Intergenic
1003049961 6:2771149-2771171 GCAGCTGCAGAGTCCACAGCAGG - Intronic
1006866366 6:37212066-37212088 GGTTCTGCTGAGTCCTTTGGAGG - Intergenic
1007229529 6:40338605-40338627 GGAGTGGCTGTGTCCACTGCAGG + Intergenic
1007275165 6:40667930-40667952 GGTGATGGTGATGCCACTGCTGG + Intergenic
1010029385 6:71257345-71257367 GATGCGGCTGTGTCCTCTGCGGG - Intergenic
1011249844 6:85359610-85359632 GGGGCTGCTAAGTCCCCTTCGGG + Intergenic
1013189102 6:107786808-107786830 GTGGTTGCTGAGTCCTCTGCAGG - Intronic
1015787905 6:136936867-136936889 GGTGCTGGTGAGAGCACTTCTGG - Intergenic
1016962807 6:149689592-149689614 GGTGGTGCTGAGGCCATTGAAGG - Intronic
1018221877 6:161589241-161589263 TGTGCTTCAGGGTCCACTGCAGG + Intronic
1019290208 7:246575-246597 CGTCCTGCTGTGTCCAGTGCAGG - Intronic
1023024484 7:36038409-36038431 GGCTCAGCTGGGTCCACTGCTGG - Intergenic
1024834631 7:53502177-53502199 GGTGCAGCTGATTTCTCTGCTGG + Intergenic
1025908466 7:65808455-65808477 GGTGCTGCTGAGCACCGTGCAGG - Intergenic
1025980617 7:66402283-66402305 GGTGCTGCTGAGCACCGTGCAGG + Intronic
1025997456 7:66537005-66537027 AGAGCTGCTGAGAACACTGCAGG - Intergenic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1026759284 7:73114357-73114379 GGTGTGGCTGAGTCCATTGCTGG + Intergenic
1026990331 7:74581480-74581502 AGAGCTGCTGAGGACACTGCAGG - Intronic
1027088124 7:75279116-75279138 GGTGTGGCTGAGTCCATTGCTGG - Intergenic
1027734372 7:81914405-81914427 GCTGCTGCTGAGTCTGCAGCGGG + Intergenic
1028511773 7:91633098-91633120 GGTGCTGCTGTTTGCACAGCTGG + Intergenic
1029394231 7:100296272-100296294 GGTGTGGGTGAGTCCATTGCTGG - Intergenic
1030855860 7:114556376-114556398 GCTGCTGCTGCTTCCCCTGCAGG + Intronic
1031402250 7:121339284-121339306 GGTGCTGCTATGTCCGTTGCAGG + Exonic
1031952943 7:127910897-127910919 GTAGCTGCTGGCTCCACTGCTGG + Intronic
1032237264 7:130136144-130136166 GGAGCTGCTGAGCCCTGTGCAGG + Intergenic
1032469769 7:132169899-132169921 GGAGCTTCTGAGAACACTGCAGG + Intronic
1032919167 7:136526814-136526836 GGAGCTGCCCACTCCACTGCAGG - Intergenic
1033899338 7:146116437-146116459 GGTGCAGCTGTTGCCACTGCGGG - Exonic
1034438535 7:151075218-151075240 GGTGCTGCTGAGGCCCAGGCTGG - Intronic
1034882940 7:154776167-154776189 GGGGCTTCTGAGGCCACTGTAGG - Intronic
1034995061 7:155571807-155571829 GGGCCTACTGAGTCCACAGCGGG - Intergenic
1035141471 7:156766770-156766792 AGTGAGGCTGAGCCCACTGCTGG + Intronic
1035468913 7:159097443-159097465 TGTGCTGCTGAGGCCATTCCCGG + Intronic
1035746939 8:1967846-1967868 GGTGTTCCTGATCCCACTGCTGG - Intergenic
1036700668 8:11011823-11011845 CTTGCTTCTGGGTCCACTGCAGG + Intronic
1037604410 8:20425343-20425365 GGGCCTCCTGAGTCCACAGCTGG - Intergenic
1037629195 8:20637645-20637667 GGGCCTGCTGAGGCCATTGCGGG - Intergenic
1038615148 8:29086979-29087001 GGTGCTGCTAAGTCCAGCACTGG + Intronic
1039800771 8:40952597-40952619 TGTACTGCTGAGTCCACTGTCGG - Intergenic
1040079598 8:43274173-43274195 GGTGCTGCTGCCTCCCCTGCAGG + Intergenic
1041205583 8:55495253-55495275 GGTGCTTCTGAGCCTGCTGCAGG + Intronic
1046697772 8:117361006-117361028 GGTGCTGCTGAGTCCACTTGGGG + Intergenic
1049336488 8:142089405-142089427 GCTGCTGCAGTCTCCACTGCTGG - Intergenic
1049509779 8:143021744-143021766 GCTGCTGCTGAGCCTGCTGCCGG + Exonic
1049729405 8:144168202-144168224 GCTGCAGGTGTGTCCACTGCAGG + Intronic
1049835224 8:144730950-144730972 GGTGCTGCTGTCTCCTCTGAGGG - Intronic
1051348416 9:16173863-16173885 GGTGGGGCTGAGACCTCTGCAGG + Intergenic
1051856881 9:21577638-21577660 GGGGCTGGTGAGTCCACAGTAGG + Intergenic
1055106706 9:72521140-72521162 GGTGCTGCTGGTGCTACTGCGGG - Intergenic
1055409961 9:76018433-76018455 GGTGCTGCTGATTCGACAGGAGG - Intronic
1056381017 9:86057516-86057538 GGTGCAGCTGAGGCCACTGTGGG + Intronic
1057025376 9:91731060-91731082 GGTGCTGCAGGGCCCACGGCTGG + Exonic
1058040392 9:100295759-100295781 GGTGCTGCTGGGCCCACTGAGGG + Intronic
1059520296 9:114934437-114934459 GGTGCTACTGCTGCCACTGCTGG - Intergenic
1060205478 9:121680385-121680407 GGTGATTCTGAGTCCCCAGCTGG + Intronic
1060261058 9:122073890-122073912 GTAGCTGATGAGTCCACTGTGGG - Intronic
1060818726 9:126649575-126649597 GGTGATGCTGAGGCCACTGATGG + Intronic
1060992718 9:127857926-127857948 GGAGGAGCTGAGTCCACAGCTGG - Intergenic
1061009776 9:127948126-127948148 GGTGCTGCTGCCCCCACTGCTGG + Exonic
1061318428 9:129812585-129812607 GCTGCTGCAGAGAGCACTGCAGG - Intergenic
1062211555 9:135366950-135366972 GGTGCAGAGGAGTCCTCTGCTGG - Intergenic
1062424940 9:136501844-136501866 GGTGCTGCTGAGTCCACTGCCGG + Exonic
1062464074 9:136673548-136673570 GGTCCAGCTGAGCCCCCTGCAGG + Exonic
1062498112 9:136841077-136841099 GGCGCAGCTGAGGCCACTGTGGG - Exonic
1186560684 X:10609596-10609618 TGTGCTTCTAAGTCTACTGCCGG + Intronic
1186594271 X:10964187-10964209 GGTGCTCCTCATTCCCCTGCAGG + Intergenic
1186925326 X:14327413-14327435 GGTTCTGCAGGGTCAACTGCAGG + Intergenic
1187846011 X:23538615-23538637 GGTTCTGCAGGGCCCACTGCAGG - Intergenic
1192759865 X:74085933-74085955 GCTGCTGCTGCTTCCACTGCTGG + Intergenic
1193203083 X:78715175-78715197 GGTCTTGCTGTGGCCACTGCTGG - Intergenic
1196007695 X:110853358-110853380 GGTACTGCTGACACCACTGTGGG + Intergenic
1196154672 X:112415493-112415515 GATGCTGCTGTGAACACTGCAGG + Intergenic
1196214623 X:113035928-113035950 GCTGCTGCTGCCGCCACTGCTGG + Intergenic
1197346093 X:125326885-125326907 GGTGCTGCTGAGAGCACCGCTGG - Intergenic
1197370710 X:125622199-125622221 GGTGTTGTGGAGTCTACTGCTGG + Intergenic
1197655627 X:129113199-129113221 GGTCCTGATGAGACTACTGCGGG - Intergenic
1199854570 X:151750009-151750031 GGCCCTGCTCAGTCCTCTGCTGG - Intergenic
1200039069 X:153353046-153353068 GGTGCTGTTGTGGCCCCTGCTGG + Intronic
1200162418 X:154016355-154016377 GGGGCTGCAGAGTGCACTGCGGG - Intronic