ID: 1062425082

View in Genome Browser
Species Human (GRCh38)
Location 9:136502373-136502395
Sequence TGCTGCTGTCCCGCAAGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062425082_1062425088 10 Left 1062425082 9:136502373-136502395 CCGGCGCTTGCGGGACAGCAGCA 0: 1
1: 0
2: 0
3: 20
4: 88
Right 1062425088 9:136502406-136502428 CACGAAGAACAGAAGCACAAAGG 0: 1
1: 0
2: 1
3: 16
4: 226
1062425082_1062425089 13 Left 1062425082 9:136502373-136502395 CCGGCGCTTGCGGGACAGCAGCA 0: 1
1: 0
2: 0
3: 20
4: 88
Right 1062425089 9:136502409-136502431 GAAGAACAGAAGCACAAAGGCGG 0: 1
1: 0
2: 2
3: 49
4: 552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062425082 Original CRISPR TGCTGCTGTCCCGCAAGCGC CGG (reversed) Exonic
900309290 1:2025544-2025566 GCCTGCTGTCCCGCCAGCTCTGG - Exonic
901490218 1:9592889-9592911 AGCTGCTGTCCCCCCAGAGCTGG + Intronic
904169525 1:28581766-28581788 TGCTGCTGGCGCGCACTCGCCGG - Intergenic
913568151 1:120093951-120093973 TGCTGCTGTTTCTCAAGCACAGG - Intergenic
914549995 1:148705718-148705740 TGCTGCTGTTTCTCAAGCACAGG - Intergenic
922025318 1:221743316-221743338 TGCGGCTGTTCCAGAAGCGCCGG - Intergenic
922581804 1:226703646-226703668 TGCTGCGGGCCCGCTAGCGCTGG - Intronic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
924754778 1:246931456-246931478 GGCTTCTGCCCCGCGAGCGCCGG - Intronic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1069019155 10:63466028-63466050 GGCTGCTGCCCCGCCCGCGCCGG - Intergenic
1070151531 10:73808220-73808242 TGCTGCAGTCTCCCAAGGGCAGG + Exonic
1070809623 10:79291058-79291080 TGCTGCTGCCCCGCAAACTGTGG - Exonic
1071271907 10:84015382-84015404 TGTTGCTATCCAGCAAGCACTGG + Intergenic
1076124816 10:127965755-127965777 TGATGCTGTCCAGCAGGAGCTGG - Intronic
1077361188 11:2140770-2140792 TGCTGCTGTCCCGCCGGTGCTGG - Intronic
1084425321 11:69081130-69081152 TGCAGCCTTCCCGCAAGGGCTGG + Intronic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1085784555 11:79438848-79438870 TGCTGCTGTCCCCAAAGAACCGG - Intronic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1086600583 11:88628669-88628691 TGCTGCTGTCCATCAGGAGCAGG + Intronic
1087470145 11:98563223-98563245 TGCTGCTGTCCTTCAAGTCCTGG - Intergenic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1095587382 12:43863930-43863952 TCTAGCTGGCCCGCAAGCGCCGG - Intronic
1096791334 12:54047068-54047090 TGCTTCTCGCCCGCCAGCGCAGG + Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1113606248 13:111609672-111609694 AGCTGGAGTCCCGCAAGTGCAGG - Intronic
1115664891 14:35535002-35535024 TGCGGCTGCCCCCCAAGCCCCGG - Exonic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116653745 14:47626588-47626610 TCGCGCTGGCCCGCAAGCGCCGG - Intronic
1117119644 14:52553359-52553381 TGCTCCTGTACCGCGAGCGGCGG + Exonic
1118389008 14:65280814-65280836 TGCAGCTGCCCCGCGAGGGCCGG + Intergenic
1121245646 14:92459354-92459376 TGCAGCTGTCTTGCAAGGGCTGG + Intronic
1121252015 14:92506343-92506365 TGCTGCTGACCTGCAAGCAGGGG + Intergenic
1128512870 15:68324474-68324496 TGCTGCTGTGCTGCAAGAGCAGG - Intronic
1132726744 16:1342207-1342229 TCCTGCTGTCCCGTTTGCGCGGG - Exonic
1132874636 16:2130891-2130913 TGCTGCTGTCTCGCAAATGCTGG - Intronic
1134553578 16:15149724-15149746 TGCTGCTGTCTCGCAAATGCTGG - Intergenic
1137445111 16:48526886-48526908 TGCTGCTGGGCTGCAAGCCCTGG - Intergenic
1137731447 16:50693517-50693539 TGCTGCGGTCCCGGCAGAGCAGG + Intergenic
1138082795 16:54107790-54107812 TGCTGCCGTCCAGCAAGGGGTGG - Intronic
1142703845 17:1681821-1681843 TCCTGCTGTCCCTCAACGGCTGG + Exonic
1144529031 17:16018316-16018338 TGCTTCTGTCCCACATGCTCTGG + Intronic
1146279939 17:31538352-31538374 TGGTGCTGTCCCCCAGGGGCAGG + Intergenic
1149058279 17:52390606-52390628 TCCTGCTGACCCACAAGCCCAGG - Intergenic
1149655930 17:58309619-58309641 TGCTCCTGTCCCACAGGGGCTGG - Intronic
1151745150 17:76007973-76007995 TGCTCCTGGACCGCAAGAGCGGG - Exonic
1152537218 17:80957738-80957760 TGCAGGTGTCCCCCAAGCCCTGG + Intronic
1152757113 17:82091661-82091683 TGCTGCTGTCCCTGGAGCACGGG - Exonic
1160498042 18:79386601-79386623 TGCTGCTGCCCCACAGCCGCAGG - Intergenic
1160904191 19:1444919-1444941 GGCAGCTGACCCGCAAGCGCCGG - Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
935579738 2:104746165-104746187 TGCTGCTGTCCAGCATGCTTGGG + Intergenic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948851847 2:240712134-240712156 TGCTGCCGTCCAGCGAGGGCTGG - Intergenic
1174261063 20:49295626-49295648 TGCTGCGGTCCCAGAAGTGCTGG - Intergenic
1175828665 20:61950679-61950701 TGCTGCTGCCCAGCAGGGGCCGG - Intergenic
1175884403 20:62280938-62280960 TGCTGCTCTCCCGCGGGTGCCGG + Intronic
1179925532 21:44532080-44532102 GGCTGCTGGCCCCCAAGCCCTGG + Intronic
1180019904 21:45116280-45116302 TGCTGCTGCGCAGCAAGCACAGG - Intronic
1180951925 22:19724352-19724374 TGCTGCTGTGCCGCCTGCGGAGG + Exonic
1184769486 22:46589193-46589215 TGCTGCCTTCCCGAAAGCCCTGG + Intronic
1185328039 22:50237140-50237162 TGCTGCTGAGCTGCAAGGGCTGG - Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953481602 3:43256884-43256906 TGCTGATGTCCCCCAATCCCAGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
961039928 3:123670995-123671017 TGGATCTGTCCCGCAAGAGCTGG - Intronic
961510010 3:127395112-127395134 TGCTGCCGTCCCGCCATCGAGGG - Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
963051447 3:141147200-141147222 AGCTGATGTCCTGCAGGCGCTGG - Exonic
967036463 3:185651964-185651986 TGCTGCTGCCCACCAAGCTCAGG - Intronic
967229612 3:187324995-187325017 TGGTGCTGTCCCACAAGCCAAGG + Intergenic
967493665 3:190120488-190120510 TGCGGATTTCCCGCAGGCGCCGG + Exonic
971422896 4:26490275-26490297 TGCTGCTTTCCACCAAGTGCTGG + Exonic
975298791 4:72765930-72765952 TCCTGCTGGCCTGCAAGCACCGG - Intergenic
980827347 4:138088898-138088920 TCGTGCTGGCCTGCAAGCGCCGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
987287546 5:16472716-16472738 TGCTGCTGTCCCTAGAGAGCTGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
994367291 5:98929635-98929657 AGCTGATGTCCCGCACGGGCGGG + Intergenic
997183466 5:131857756-131857778 CTTTGCTGGCCCGCAAGCGCAGG + Intronic
998343733 5:141441941-141441963 TGCTGCAGGCCAGCAAGCCCAGG + Intronic
1001524427 5:172418581-172418603 TGTTGCAGGCCCGCAAGGGCTGG + Intronic
1001954943 5:175842693-175842715 AGCAGCTGTCCTGCAAGTGCAGG - Intronic
1002710656 5:181192660-181192682 AGCTGCTGACCCATAAGCGCAGG - Intergenic
1003011663 6:2432888-2432910 GGCTGCTGTCCCACAAGGGCTGG + Intergenic
1004350714 6:14888044-14888066 TGCTTCTTTCCCCCAAGCCCAGG - Intergenic
1010230317 6:73528799-73528821 TGCTGCTGTCCTCCAAACCCAGG - Intergenic
1018467787 6:164067173-164067195 TGCTCCTGTACCCCAAGGGCAGG - Intergenic
1018551359 6:165001912-165001934 TCGTGCTGGCCCGCGAGCGCTGG + Intergenic
1019147300 6:169983552-169983574 TGCTGCGGTCCCGTCAGCTCAGG - Intergenic
1023857761 7:44195083-44195105 TTCTGCTGTACAGCAAGGGCTGG + Intronic
1030073803 7:105719832-105719854 TTCTGCTTTTCAGCAAGCGCAGG + Intronic
1032084135 7:128874704-128874726 TTCTGGTGCCCCGCAAGCCCAGG - Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1044853550 8:96452364-96452386 TCTTGCTGGCCAGCAAGCGCCGG - Intergenic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1049619676 8:143592413-143592435 AGCTGCTGACCCGCCAGCCCAGG + Intronic
1049653737 8:143788726-143788748 GGCTGCTGTCCCCAAAGCCCAGG - Intergenic
1055460704 9:76517752-76517774 TGAGGCTGTCCTGCAAGCCCTGG + Intergenic
1058369217 9:104245805-104245827 AGCTGCTCTCCAGCAAGCCCTGG - Intergenic
1058969274 9:110065108-110065130 GGCTGCTGTCACGGAAGTGCAGG - Intronic
1062425082 9:136502373-136502395 TGCTGCTGTCCCGCAAGCGCCGG - Exonic
1062522661 9:136964744-136964766 TGCTGCCTTGCCGCAAGCTCGGG + Intergenic
1188881779 X:35499307-35499329 TCCCGCTGGCTCGCAAGCGCCGG - Intergenic
1189304866 X:39979369-39979391 TGGTGCTGACCCGCTAGCCCTGG - Intergenic