ID: 1062425572

View in Genome Browser
Species Human (GRCh38)
Location 9:136504632-136504654
Sequence AGAGTTGCGGGGATTGACCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062425558_1062425572 18 Left 1062425558 9:136504591-136504613 CCGGCCGTGAGGGGCAGGGAGGC 0: 1
1: 0
2: 4
3: 28
4: 319
Right 1062425572 9:136504632-136504654 AGAGTTGCGGGGATTGACCGTGG 0: 1
1: 0
2: 0
3: 2
4: 44
1062425566_1062425572 -4 Left 1062425566 9:136504613-136504635 CCGTCGGGGAGGGCCCAGGAGAG 0: 1
1: 0
2: 1
3: 51
4: 267
Right 1062425572 9:136504632-136504654 AGAGTTGCGGGGATTGACCGTGG 0: 1
1: 0
2: 0
3: 2
4: 44
1062425554_1062425572 26 Left 1062425554 9:136504583-136504605 CCATGGCGCCGGCCGTGAGGGGC 0: 1
1: 0
2: 0
3: 13
4: 126
Right 1062425572 9:136504632-136504654 AGAGTTGCGGGGATTGACCGTGG 0: 1
1: 0
2: 0
3: 2
4: 44
1062425559_1062425572 14 Left 1062425559 9:136504595-136504617 CCGTGAGGGGCAGGGAGGCCGTC 0: 1
1: 0
2: 1
3: 18
4: 230
Right 1062425572 9:136504632-136504654 AGAGTTGCGGGGATTGACCGTGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062425572 Original CRISPR AGAGTTGCGGGGATTGACCG TGG Intronic