ID: 1062426110

View in Genome Browser
Species Human (GRCh38)
Location 9:136507014-136507036
Sequence CACGCGGCACGGCAGGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 162}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062426110_1062426126 26 Left 1062426110 9:136507014-136507036 CCCCGGCCCTGCCGTGCCGCGTG 0: 1
1: 0
2: 1
3: 7
4: 162
Right 1062426126 9:136507063-136507085 TCTGGGGCTGCACGGACACTCGG 0: 1
1: 0
2: 0
3: 14
4: 137
1062426110_1062426122 8 Left 1062426110 9:136507014-136507036 CCCCGGCCCTGCCGTGCCGCGTG 0: 1
1: 0
2: 1
3: 7
4: 162
Right 1062426122 9:136507045-136507067 GGAAGACGAGCGCTCAGGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 89
1062426110_1062426123 9 Left 1062426110 9:136507014-136507036 CCCCGGCCCTGCCGTGCCGCGTG 0: 1
1: 0
2: 1
3: 7
4: 162
Right 1062426123 9:136507046-136507068 GAAGACGAGCGCTCAGGTCTGGG 0: 1
1: 0
2: 0
3: 4
4: 88
1062426110_1062426119 3 Left 1062426110 9:136507014-136507036 CCCCGGCCCTGCCGTGCCGCGTG 0: 1
1: 0
2: 1
3: 7
4: 162
Right 1062426119 9:136507040-136507062 GTCCCGGAAGACGAGCGCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 38
1062426110_1062426127 27 Left 1062426110 9:136507014-136507036 CCCCGGCCCTGCCGTGCCGCGTG 0: 1
1: 0
2: 1
3: 7
4: 162
Right 1062426127 9:136507064-136507086 CTGGGGCTGCACGGACACTCGGG 0: 1
1: 0
2: 0
3: 16
4: 193
1062426110_1062426124 10 Left 1062426110 9:136507014-136507036 CCCCGGCCCTGCCGTGCCGCGTG 0: 1
1: 0
2: 1
3: 7
4: 162
Right 1062426124 9:136507047-136507069 AAGACGAGCGCTCAGGTCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 69
1062426110_1062426125 18 Left 1062426110 9:136507014-136507036 CCCCGGCCCTGCCGTGCCGCGTG 0: 1
1: 0
2: 1
3: 7
4: 162
Right 1062426125 9:136507055-136507077 CGCTCAGGTCTGGGGCTGCACGG 0: 1
1: 0
2: 3
3: 17
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062426110 Original CRISPR CACGCGGCACGGCAGGGCCG GGG (reversed) Intronic
900154294 1:1197879-1197901 CAGGCAGCACGGCTGGGGCGCGG - Exonic
900177004 1:1295402-1295424 CAGGTGGCAGGGCAGGGCCAAGG - Intronic
900366946 1:2315257-2315279 CCCGCGGCACGGTGGGGGCGGGG + Intergenic
900623518 1:3598056-3598078 CAGGCTGCAGGGCAGGCCCGGGG - Intronic
901820919 1:11828886-11828908 CAAGCTGCTCGGCAGGGCCACGG - Intronic
903735899 1:25529870-25529892 CACGCTGCACTGCAGGTGCGGGG + Intergenic
903788246 1:25875411-25875433 CACGGGGCGCGGCGGGGCTGCGG - Intergenic
903788444 1:25876120-25876142 CACTCGGCTGGGCAGAGCCGGGG - Intergenic
904251894 1:29230974-29230996 CACCCGGCGGGGCAGGGGCGGGG - Intergenic
907285584 1:53377456-53377478 CAGGAGGCCTGGCAGGGCCGGGG + Intergenic
907516639 1:54997201-54997223 CACGAGGCCCTGCAGGACCGCGG + Intergenic
910759286 1:90718853-90718875 CGCGGGGCGCGGCAGGGGCGCGG - Intergenic
911078993 1:93909506-93909528 CCCGCGGCGGGGCAGGGGCGGGG + Intergenic
913486377 1:119335519-119335541 CAAGCGGCATGGCAGGGACCAGG + Intergenic
920198113 1:204243031-204243053 CAAGGGGCAAGGCAGGGCCCTGG - Intronic
920616398 1:207496523-207496545 CGCGCGACCCGGCAGGGCGGCGG + Intronic
921172102 1:212558984-212559006 CGCGCGGCCCGGCGGGGGCGGGG + Intergenic
921946089 1:220887082-220887104 CAGGGGGCACGGCAGAGCTGGGG + Intergenic
923207916 1:231776503-231776525 CTCGCGGCAGGGCTGGGCTGGGG + Intronic
924384731 1:243490396-243490418 CACGCTCCATGGCAGGGCCCTGG + Intronic
1063071727 10:2672747-2672769 CACACGGGACGGGAGGGCTGTGG + Intergenic
1067067254 10:43111008-43111030 AACGGGGCAGGGCAGGGCTGGGG + Intronic
1069744279 10:70705220-70705242 CAGGGGCCAAGGCAGGGCCGCGG - Intronic
1069995737 10:72341071-72341093 CAGGCGGCCCGGCACGGCCATGG - Exonic
1072617992 10:97062565-97062587 CACCCTGCAGGGCAGGGCCCAGG - Intronic
1072915482 10:99535282-99535304 CACGCGGCGCGGCGGCGGCGGGG - Exonic
1074772020 10:116741169-116741191 CACGCGGCACTGCAGTGGTGGGG - Intronic
1075078555 10:119367953-119367975 CAGGCGCCTCGGCAGGGCCAGGG + Intronic
1075096291 10:119473781-119473803 CAGGCAGCACAGCAGGGCTGCGG - Intergenic
1075106618 10:119543425-119543447 CGCGCGGCACGGCCGGGGAGAGG - Intergenic
1075631980 10:124006002-124006024 CACAGGGGAGGGCAGGGCCGGGG - Intergenic
1077491921 11:2864901-2864923 CACACGGCACCTCAGGGCCCAGG - Intergenic
1077500882 11:2909346-2909368 CACGCTGCCAGGTAGGGCCGGGG + Exonic
1078066280 11:8081353-8081375 CGCGCTGCACGCCAGGGCCCCGG - Intronic
1083189845 11:61042054-61042076 CACAGGGCATGGCAGGGCTGAGG + Intergenic
1088480836 11:110295850-110295872 CACCCGCCAGGCCAGGGCCGCGG - Intronic
1089494796 11:118902599-118902621 CCCCCAGCAGGGCAGGGCCGGGG + Exonic
1089694975 11:120211238-120211260 CACGCGGCGCGCCGGGGCCGCGG + Exonic
1094841620 12:34344790-34344812 AACCCGGCACAGCAGGGCAGGGG - Intergenic
1098369322 12:69739503-69739525 GACGCCGCGCGGCAGGGCTGTGG + Exonic
1103595451 12:122022279-122022301 CCCGCGGCGGGGCTGGGCCGGGG - Intronic
1106087817 13:26558371-26558393 CACGCGGCACCGCAGCCTCGAGG - Intronic
1112402088 13:99086387-99086409 CGCGCGGCCGGGCCGGGCCGCGG - Intronic
1113379146 13:109786822-109786844 CACCCCGCCCGGCCGGGCCGGGG - Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1117996290 14:61481187-61481209 CACGTGGTACGCCAGGGCCTGGG - Intronic
1118821518 14:69349195-69349217 CCCACTGCAGGGCAGGGCCGAGG - Intronic
1119290495 14:73491451-73491473 CGCGGTGCACAGCAGGGCCGAGG - Exonic
1122313507 14:100812264-100812286 GACCCGGCATGGCAGGGCCCCGG + Intergenic
1122891816 14:104735564-104735586 CACATGGCTCGGCAGGGCCGGGG - Intronic
1122940342 14:104978336-104978358 CCCGCGGCAGCGCAGGGCAGCGG - Exonic
1123106834 14:105845724-105845746 CAAGGGGCAGGGCAGGGCAGAGG + Intergenic
1126600678 15:50424337-50424359 CAGACGTCACGGCAGGGGCGGGG - Intergenic
1129189043 15:73927079-73927101 CACGCGCCCCGGCAGGGGCAGGG - Exonic
1129408611 15:75336444-75336466 CAAGCCCCACGGCAGGGCTGGGG - Intronic
1129460905 15:75699698-75699720 CAGGCGGGAGGGCTGGGCCGGGG + Intronic
1133079299 16:3305737-3305759 CGCGCGGCCCGGAAGCGCCGCGG - Intronic
1136483197 16:30555503-30555525 CACGTGGCGCCGCAGGTCCGAGG + Exonic
1139545758 16:67648802-67648824 GAGGCGGAAGGGCAGGGCCGTGG + Intronic
1141054511 16:80803681-80803703 TGCGCGGCCCGGCTGGGCCGGGG - Intronic
1141430624 16:83968804-83968826 CGCGCGGCGAGGCTGGGCCGGGG - Exonic
1142356067 16:89602679-89602701 CCCCTGGCACAGCAGGGCCGTGG + Intergenic
1142509878 17:386374-386396 CTCGCTGGACGGCAGGGGCGCGG + Intergenic
1142764570 17:2058025-2058047 AGCGCTGTACGGCAGGGCCGAGG + Exonic
1143036877 17:4004391-4004413 CACGAGACACGGCGGGGCGGAGG + Intergenic
1143107282 17:4536090-4536112 CACGCGGCGCGCCACTGCCGTGG + Exonic
1143140472 17:4739491-4739513 GTCGGGGCACAGCAGGGCCGGGG - Exonic
1143608229 17:8003087-8003109 CACGCGGGACCGCAGAGCCCGGG - Exonic
1143750302 17:9022336-9022358 TCCTCGGCGCGGCAGGGCCGGGG + Exonic
1144574979 17:16423680-16423702 CAAGCTGCACGGTAGGGCAGAGG - Exonic
1151156197 17:72124217-72124239 CACGCGGCAGGCCAGGGCACCGG + Exonic
1151569719 17:74920202-74920224 CACGCTGCACGGCACGGCCAGGG - Exonic
1151716009 17:75831373-75831395 GACACAGCACGGCAGGGCGGTGG + Intronic
1152032440 17:77852826-77852848 GAGGCGGCAGGGCAGAGCCGCGG + Intergenic
1152355972 17:79807490-79807512 CAGGGGGCAGGGCAGGGCAGAGG + Intergenic
1152912689 17:83014018-83014040 CACGGGGCACTGCTGGGCTGAGG + Intronic
1154354693 18:13616160-13616182 CACGTGGCAGGGCAGGGAGGTGG - Intronic
1160858669 19:1228518-1228540 CTCGGGGCGCGGGAGGGCCGGGG + Exonic
1160895426 19:1400006-1400028 CACAGGGCAGGGCAGGGCTGGGG + Intronic
1161055818 19:2190216-2190238 CACGAGACACAGCAGGACCGGGG - Intronic
1161069044 19:2251389-2251411 CACGCGGCGCGCCAGGGCCGTGG - Exonic
1162033128 19:7925851-7925873 CACGCCGCGCGCCCGGGCCGCGG - Intronic
1162301224 19:9846264-9846286 CACGTGGGCCGGCAGGGCCAAGG + Intronic
1163655686 19:18543580-18543602 CAATGGGCACGGCAGGGGCGGGG - Exonic
1163715079 19:18868702-18868724 CACGCAGCAGGGCAGGTCGGCGG + Exonic
1163720493 19:18896145-18896167 CACGCGCCGCAGCTGGGCCGGGG + Intronic
1164402016 19:27909429-27909451 CACCAGGCACGGTAGGGACGGGG - Intergenic
1165268018 19:34677782-34677804 TACGCGGCGCGTCAGGTCCGCGG + Exonic
1166215355 19:41331154-41331176 CACGCAGCACGGCGCCGCCGAGG + Exonic
1167467634 19:49658527-49658549 CACGGGGCAGGGCAGGGCAGGGG - Exonic
1167590541 19:50402253-50402275 CACGAGGCGCGGCAGCGCCACGG - Exonic
1168239832 19:55083526-55083548 CAAGCGACACAGCAGGGCCGAGG + Intronic
926089998 2:10043535-10043557 CTCGCGGCGCGGGAGGGGCGGGG - Exonic
926251846 2:11159321-11159343 CCTGCGGCAGGGCAGGGCAGAGG + Intronic
929468705 2:42169703-42169725 CAGGCGGGAGGGCAGGGCCTGGG - Intronic
930033869 2:47073783-47073805 CACGAGGCGTGGCAGGGCCTGGG + Exonic
934105548 2:88691746-88691768 CCCGCTGCCCGGGAGGGCCGGGG + Exonic
934656923 2:96121240-96121262 CTCGGGGCAAGGCAGGGCTGGGG - Intergenic
935595196 2:104872643-104872665 CACGCGGGCCGGCGGGGCGGAGG - Intergenic
937288177 2:120766114-120766136 CACGCGGCAAGGCTGGGGCTGGG + Intronic
939969555 2:148644601-148644623 CCCGCGGGCCGGCAGCGCCGCGG + Intronic
947542968 2:230991179-230991201 CCCGCGGGGCGGCAGGGTCGGGG - Intergenic
947637784 2:231688808-231688830 CACGCCGCTCGGCAGGGCTGCGG + Intergenic
948679235 2:239621440-239621462 CACGTGGCGCAGCAGGGCTGGGG - Intergenic
948689248 2:239691553-239691575 CACACGGCAGGGGAGGGCTGGGG + Intergenic
949050098 2:241893107-241893129 CACGTGGCACAGCAGGGACCTGG + Intergenic
1168830891 20:844842-844864 CAGGCGGCAAGGTAGGGCGGGGG - Exonic
1169263258 20:4152672-4152694 CAAGAGGCAGGGCAGGGCCCTGG + Intronic
1171413988 20:24965267-24965289 GAGGCGGCAGGGCAGGGCCCAGG - Intronic
1172978340 20:38922870-38922892 CACGCGGCACCGGTGGGCCTTGG + Exonic
1173165284 20:40683352-40683374 CACGGGGCACAGCAGGCCCCCGG - Intergenic
1175215281 20:57389293-57389315 CAGGCGGCAGGGCAGCCCCGGGG - Intergenic
1175429512 20:58891644-58891666 CACGCGGGCCGGGAGGGCCGGGG - Intronic
1176080051 20:63267910-63267932 AACGGGGCAGGGCAGGGCCAGGG + Intronic
1179225115 21:39445986-39446008 CACGCGGGAAGGCAGGGTCCCGG - Intronic
1179375482 21:40846815-40846837 CACGCGGCGCGGCCGGGCTCCGG + Exonic
1179675038 21:42975105-42975127 CGCGCGGCGGGGCGGGGCCGGGG + Intronic
1180259828 21:46661742-46661764 CGCGTGGCACCGCAGGGCCCGGG - Intronic
1181494691 22:23281359-23281381 CACACGGCAAGGGTGGGCCGGGG - Intronic
1183585096 22:38748790-38748812 CACGCGGGAGGGCAGGACGGGGG + Intronic
1184236872 22:43187361-43187383 CAGGGGGCGCGGCAGGGGCGGGG - Intergenic
1185329605 22:50246261-50246283 CACGCGGCAAGGCAGGTGCTGGG - Intronic
950034707 3:9877132-9877154 TACGCGGCAGGGCCGGGCCCTGG + Exonic
953910934 3:46892745-46892767 GACGCGCCAAGGCGGGGCCGGGG - Intronic
954370815 3:50168772-50168794 CAAGAGGCATGGCAGGGCCCAGG - Intronic
960829866 3:121835010-121835032 CACGCCGCACTACAGCGCCGCGG + Exonic
966411750 3:179652822-179652844 AACGCGGCGCGGGAGGGCCCCGG - Exonic
967433654 3:189419030-189419052 CACGGGGCAGGGAAGGGTCGGGG + Intergenic
972396573 4:38663872-38663894 CACGAGGCGCGGCGCGGCCGTGG - Intergenic
977908167 4:102501172-102501194 CGAGCGGCAAGGCCGGGCCGGGG + Intergenic
981067275 4:140498298-140498320 CACGCGGCACCGCGGGGAGGGGG - Intronic
981748628 4:148073260-148073282 CACGGGGCAGGGCAGGGTCAAGG - Intergenic
984754676 4:183314079-183314101 CAAGCGGGAGGGCAGGGCCACGG + Intronic
985895534 5:2748491-2748513 AACGCGGCGCTGCAGGGCCAGGG - Exonic
990165464 5:52989208-52989230 CCCGCGGGGCCGCAGGGCCGGGG + Intergenic
995402479 5:111757887-111757909 CCGGCGGCCCGCCAGGGCCGTGG + Intronic
997529220 5:134571868-134571890 CACACGGCAGGGCAGAGCCTGGG - Intronic
1002461199 5:179374730-179374752 CACGCAGGACGTCAGGGCAGAGG + Intergenic
1002632780 5:180591824-180591846 CTCGCGCCAGGGCAGGGGCGGGG + Intergenic
1007072471 6:39047755-39047777 CATGCCCCACGGCAGGTCCGAGG + Intergenic
1011931816 6:92723675-92723697 CACGAGGGACGGCAGTGCTGGGG - Intergenic
1015776791 6:136822739-136822761 CAGGCGGCCCGGCAGGTACGGGG - Exonic
1019279366 7:192461-192483 CACGAGTCACGGCTGGGCCCGGG - Intergenic
1022973487 7:35537300-35537322 CCCGCGGCAGGGCGGGGCGGGGG + Intergenic
1023703031 7:42911704-42911726 CAGGTGGCCGGGCAGGGCCGAGG - Intronic
1039875029 8:41578095-41578117 CGCGCGGGCCGGCAGGGCGGGGG - Intronic
1045187510 8:99854030-99854052 CACACAGCACGCCAGGGCCTTGG + Exonic
1049689751 8:143953335-143953357 CAAGGGGCAGGGCAGGGCTGGGG - Intronic
1051641811 9:19230730-19230752 CGCTCGGCAGGGCAGGGCGGGGG - Exonic
1056153979 9:83817341-83817363 CAGAGGGCACGGGAGGGCCGCGG - Intronic
1056475416 9:86947309-86947331 GACGCGGGGCGGCCGGGCCGCGG - Intergenic
1057269819 9:93644559-93644581 CACCCTGCAAGACAGGGCCGAGG - Intronic
1057445479 9:95111514-95111536 CAAGAGCCACAGCAGGGCCGTGG + Exonic
1057489031 9:95507809-95507831 CACGGGGCAGGACAGTGCCGCGG + Intronic
1057942362 9:99296423-99296445 CACACGGCGTGGCAGGGCCACGG + Intergenic
1060114469 9:120929197-120929219 AAACCGGCAAGGCAGGGCCGGGG + Intergenic
1060811553 9:126613710-126613732 CCCGCGGGGCGGCCGGGCCGGGG + Intergenic
1061216033 9:129222525-129222547 CCCGCCGCACTGCAGGGCCAGGG + Intergenic
1061856285 9:133443542-133443564 CACCTGGCAGGGCAGGGCTGGGG - Exonic
1062426110 9:136507014-136507036 CACGCGGCACGGCAGGGCCGGGG - Intronic
1062653374 9:137589962-137589984 CCTCCGGCAGGGCAGGGCCGAGG + Intronic
1185457156 X:316992-317014 CACGCTGGACGGCTGGTCCGTGG - Exonic
1185469411 X:373705-373727 CTCGGGGCAGGGCCGGGCCGGGG + Intronic
1185868286 X:3641895-3641917 CAAGGGCCACGGAAGGGCCGTGG - Exonic
1189137044 X:38561224-38561246 CACGGGGCGCGGCAGGACAGTGG - Intronic
1189197232 X:39162560-39162582 CACGTGGCGCGCCGGGGCCGCGG + Intergenic
1197642736 X:128985040-128985062 CACGTGTCATGGCAGGGACGTGG + Intergenic
1200100848 X:153688544-153688566 CGGGCCGCACGGCCGGGCCGGGG - Exonic
1200146417 X:153928494-153928516 AGCGCGGCAGGGCGGGGCCGGGG - Intronic
1200239520 X:154486459-154486481 CAGGGGGACCGGCAGGGCCGAGG - Intronic
1200795916 Y:7341169-7341191 CAAGGGCCACGGAAGGGCCGTGG + Intergenic