ID: 1062426586

View in Genome Browser
Species Human (GRCh38)
Location 9:136508838-136508860
Sequence CCGGCCACAGAGGTGCCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 97}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062426586_1062426595 14 Left 1062426586 9:136508838-136508860 CCTTCGGGCACCTCTGTGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1062426595 9:136508875-136508897 AGTTGGGGCCAGTGTAGCCCTGG 0: 1
1: 0
2: 1
3: 21
4: 203
1062426586_1062426599 21 Left 1062426586 9:136508838-136508860 CCTTCGGGCACCTCTGTGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1062426599 9:136508882-136508904 GCCAGTGTAGCCCTGGGGGCAGG 0: 1
1: 0
2: 3
3: 30
4: 335
1062426586_1062426597 16 Left 1062426586 9:136508838-136508860 CCTTCGGGCACCTCTGTGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1062426597 9:136508877-136508899 TTGGGGCCAGTGTAGCCCTGGGG 0: 1
1: 0
2: 0
3: 14
4: 195
1062426586_1062426591 -3 Left 1062426586 9:136508838-136508860 CCTTCGGGCACCTCTGTGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1062426591 9:136508858-136508880 CGGCGCACTCACCTGGCAGTTGG 0: 1
1: 0
2: 2
3: 10
4: 117
1062426586_1062426596 15 Left 1062426586 9:136508838-136508860 CCTTCGGGCACCTCTGTGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1062426596 9:136508876-136508898 GTTGGGGCCAGTGTAGCCCTGGG 0: 1
1: 0
2: 0
3: 13
4: 166
1062426586_1062426589 -10 Left 1062426586 9:136508838-136508860 CCTTCGGGCACCTCTGTGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1062426589 9:136508851-136508873 CTGTGGCCGGCGCACTCACCTGG 0: 1
1: 0
2: 2
3: 11
4: 84
1062426586_1062426592 -2 Left 1062426586 9:136508838-136508860 CCTTCGGGCACCTCTGTGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1062426592 9:136508859-136508881 GGCGCACTCACCTGGCAGTTGGG 0: 1
1: 0
2: 2
3: 5
4: 92
1062426586_1062426598 17 Left 1062426586 9:136508838-136508860 CCTTCGGGCACCTCTGTGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1062426598 9:136508878-136508900 TGGGGCCAGTGTAGCCCTGGGGG 0: 1
1: 0
2: 2
3: 31
4: 252
1062426586_1062426593 -1 Left 1062426586 9:136508838-136508860 CCTTCGGGCACCTCTGTGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1062426593 9:136508860-136508882 GCGCACTCACCTGGCAGTTGGGG 0: 1
1: 0
2: 0
3: 15
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062426586 Original CRISPR CCGGCCACAGAGGTGCCCGA AGG (reversed) Intronic