ID: 1062426629

View in Genome Browser
Species Human (GRCh38)
Location 9:136509057-136509079
Sequence CCGTTGAAGCAGGAGCTGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062426625_1062426629 -9 Left 1062426625 9:136509043-136509065 CCACGCAGGTGCCACCGTTGAAG 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1062426629 9:136509057-136509079 CCGTTGAAGCAGGAGCTGCAAGG 0: 1
1: 0
2: 0
3: 12
4: 148
1062426624_1062426629 -5 Left 1062426624 9:136509039-136509061 CCGTCCACGCAGGTGCCACCGTT 0: 1
1: 0
2: 1
3: 8
4: 62
Right 1062426629 9:136509057-136509079 CCGTTGAAGCAGGAGCTGCAAGG 0: 1
1: 0
2: 0
3: 12
4: 148
1062426622_1062426629 28 Left 1062426622 9:136509006-136509028 CCGGGTGGACACAGGCAGGTGAA 0: 1
1: 0
2: 4
3: 28
4: 338
Right 1062426629 9:136509057-136509079 CCGTTGAAGCAGGAGCTGCAAGG 0: 1
1: 0
2: 0
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062426629 Original CRISPR CCGTTGAAGCAGGAGCTGCA AGG Exonic
901454619 1:9355952-9355974 CCCCTGAAGCAGGAGCTCCAGGG + Exonic
902442962 1:16443135-16443157 CTATAGAAGCAGCAGCTGCAGGG - Intronic
904306119 1:29591555-29591577 CACTTGAAACAGGTGCTGCAAGG + Intergenic
905631394 1:39521008-39521030 CCTGTGAAGTAGGAGCTGCAGGG + Intronic
905666360 1:39765163-39765185 CCTGTGAAGTAGGAGCTGCAGGG - Intronic
907699603 1:56772132-56772154 CCATTGAAGCATGAGCTCTATGG - Intronic
908577882 1:65480378-65480400 TCTATGAACCAGGAGCTGCATGG + Intronic
908601544 1:65744985-65745007 CTGCTGAAGCTGGAGCTGCTGGG - Intergenic
915321917 1:155061036-155061058 CAGCTGGAGCAGGAGCTGCTGGG + Intronic
921519180 1:216138422-216138444 CAGTTGGAGCAATAGCTGCACGG - Intronic
922706877 1:227794831-227794853 GCATTGGGGCAGGAGCTGCAGGG + Intergenic
923334541 1:232956081-232956103 CTGTTGATGCAGTAGCTGCTTGG + Intronic
923362760 1:233228229-233228251 ACAATGAAGGAGGAGCTGCATGG - Intronic
1063549094 10:7012103-7012125 CAGTTGAAGCAGAGGCTGTATGG - Intergenic
1064223568 10:13462011-13462033 CAGTGGACTCAGGAGCTGCAGGG + Intronic
1064346110 10:14534200-14534222 CCTTTGCATGAGGAGCTGCAGGG - Intronic
1064362867 10:14681456-14681478 CCTTTGAAACATGAGCTGAAAGG - Intronic
1068608525 10:59032841-59032863 GCCTTGAAGCCTGAGCTGCAAGG + Intergenic
1071166845 10:82816815-82816837 CAGTTGCAGCAGGAGAAGCATGG - Intronic
1072276486 10:93828381-93828403 CAGCTGAGGCAGGAGCTGAAGGG - Intergenic
1073513450 10:104057049-104057071 CAGCTGCAGCAGGAGCCGCAGGG + Exonic
1077257038 11:1590281-1590303 CTGTGGAAGCTGGAGCTGCCTGG + Intergenic
1078186190 11:9053822-9053844 CCCTTGAGGAAGGAGCAGCAGGG + Intronic
1078852298 11:15175902-15175924 CCGTTTGAGCAGCAGCTGCAGGG - Exonic
1079500746 11:21098647-21098669 ATGTTGAAGCAGGTGCTCCAGGG + Intronic
1080091491 11:28354094-28354116 CCATTGGAGCAGGAGCTGAGAGG + Intergenic
1084287860 11:68143270-68143292 CCTTGGCAGCAGGAGCTGGATGG + Intergenic
1084652039 11:70495151-70495173 CGGCTGCAGCAGGTGCTGCATGG + Intronic
1090522710 11:127496247-127496269 CCGCTAATGCAGGAGGTGCAAGG - Intergenic
1091176413 11:133562261-133562283 CAATTGAAGCAGGAGCTGTTGGG - Intergenic
1095470970 12:42536455-42536477 CCGCTGAAGAGGGAGCTGGATGG - Intronic
1104064434 12:125295370-125295392 CTGTTGGGGCAGGAGCTGGAAGG + Intronic
1104592780 12:130098099-130098121 CCAGGGAAGCAGGAGCTCCAGGG + Intergenic
1104897806 12:132172822-132172844 CCGATGAGGAAGCAGCTGCAGGG + Intergenic
1106366225 13:29083479-29083501 CTGTTGAAGTGGGAGCTGAATGG + Intronic
1107692235 13:42965466-42965488 CCCTCAAAGCAGGATCTGCAAGG + Intronic
1109213530 13:59562763-59562785 CCGTTCCAGCAGAAGCTGCAGGG + Intergenic
1121337907 14:93088452-93088474 GCGTTCAAGCAGGAGCTACTTGG + Intronic
1121612514 14:95291357-95291379 CCCGAGACGCAGGAGCTGCAGGG - Intronic
1126562992 15:50064834-50064856 CGGTTGAAGCAGGAGCAAAAGGG + Intronic
1127398895 15:58565489-58565511 GCATTGAAGCAGGTGCTCCATGG + Intronic
1129143604 15:73626305-73626327 CCCTTGAAACAAGAACTGCAAGG + Intronic
1129333940 15:74841481-74841503 CCGTTCATGCAGGAATTGCAGGG + Exonic
1130833238 15:87624357-87624379 CTGTCTAAGCAGGAGCTACATGG + Intergenic
1135034281 16:19063901-19063923 CCGTTTAATCAGGAGTTGTAAGG - Intronic
1135971515 16:27075289-27075311 CTGTGGAAGCAGAAACTGCAAGG - Intergenic
1141082059 16:81061359-81061381 CCGTTTCTGCAGAAGCTGCAAGG + Exonic
1141920390 16:87131924-87131946 ACAGTGAAGCAGGAGGTGCAGGG + Intronic
1143739567 17:8942387-8942409 CAGTGGGGGCAGGAGCTGCAAGG - Intronic
1145370783 17:22304656-22304678 CCGGTGGAGAAGGAGCTTCAGGG - Intergenic
1145843075 17:28012800-28012822 TGGTGGAAGTAGGAGCTGCAAGG - Intergenic
1148570753 17:48666916-48666938 CTGGAGAAGCAAGAGCTGCATGG - Intergenic
1150238268 17:63610860-63610882 CAGGTGAAGCAGCAGCTGGACGG - Intergenic
1151472852 17:74328515-74328537 GCTCTGCAGCAGGAGCTGCAGGG + Intronic
1152874651 17:82779801-82779823 ACGTGGAAGCTGGAGCTGCCAGG - Intronic
1161202692 19:3024831-3024853 CCGCTGGGGCAGGGGCTGCAGGG - Intronic
1162490622 19:10989244-10989266 CAGTTACAGCTGGAGCTGCAGGG - Intronic
1164446436 19:28321579-28321601 CCCTTGAGCCAGGAGCTGCTGGG + Intergenic
1165510932 19:36266384-36266406 CCGGTGGAGGAGGAGCTTCAGGG - Intergenic
1165511442 19:36268804-36268826 CCGCTGAAGGAGGAGCTTCGGGG - Intergenic
1165511990 19:36271327-36271349 CCGCTGAAGGAGGAGCTTCGGGG - Intergenic
1165520256 19:36309295-36309317 CCGCTGAAGGAGGAGCTTCGGGG - Intergenic
1165595253 19:37007546-37007568 CCGGTGGAGAAGGAGCTTCAAGG - Intergenic
1165596083 19:37012111-37012133 CCGGTGGAGGAGGAGCTTCAGGG - Intronic
1165601167 19:37056763-37056785 CCGGTGGAGGAGGAGCTTCAGGG - Intronic
1167784761 19:51627798-51627820 CAGCTGGAGCAGGAACTGCATGG - Intronic
1168705877 19:58470004-58470026 CCCTTGAAGGTGGAGCTCCAAGG + Intronic
925027289 2:620133-620155 CTGTCCAAGCAGGAGCTGAAGGG - Intergenic
925072596 2:982968-982990 AGGATGAAGCAGAAGCTGCAGGG + Intronic
925508774 2:4600843-4600865 GCGATGAAGGAGGAGCTGAAAGG + Intergenic
926033381 2:9612991-9613013 CTGTTGAGAGAGGAGCTGCAAGG - Intronic
931953226 2:67388860-67388882 CTGCTGAAGCAGGATCTGCATGG - Intergenic
932219412 2:69988491-69988513 CGGTGGTTGCAGGAGCTGCAGGG + Intergenic
934699746 2:96430075-96430097 GAGTTGAAGCAGGAGCTCCTTGG + Intergenic
934950408 2:98571754-98571776 TCATTAAAGCAGGGGCTGCAGGG + Intronic
936401932 2:112171241-112171263 CAGTGGAAGGAGGACCTGCAAGG + Intronic
940011877 2:149062963-149062985 TCGGTAAAGAAGGAGCTGCAAGG + Intronic
945466097 2:210171605-210171627 GGGAGGAAGCAGGAGCTGCACGG - Intergenic
947714815 2:232334152-232334174 CCGGTGCTGCAGAAGCTGCATGG + Intronic
948829171 2:240589391-240589413 CAGGTGAAGCAGGGGCTGCTGGG + Exonic
1171523384 20:25792338-25792360 CCGGTGGAGGAGGAGCTTCAGGG + Intronic
1171531127 20:25854295-25854317 CCGGTGGAGGAGGAGCTTCAGGG + Intronic
1171553442 20:26063545-26063567 CCGGTGGAGGAGGAGCTTCAGGG - Intergenic
1172836944 20:37879158-37879180 CATTAGAAGCAGGCGCTGCAGGG + Intergenic
1175465159 20:59185743-59185765 CCACTGAGGCAGGAGCTGGACGG + Intergenic
1175844990 20:62053429-62053451 CCGGTCAGGCAGGAGCGGCAGGG + Intronic
1176705880 21:10119776-10119798 CCGGTGAAGGAGGAGCTTCGGGG + Intergenic
1178589222 21:33895158-33895180 CCGCTGAGGCTGGGGCTGCACGG + Exonic
1179778923 21:43687167-43687189 GCAGGGAAGCAGGAGCTGCAGGG + Intronic
1180144299 21:45910720-45910742 CCGTGGTAGCAGGGGCAGCATGG + Intronic
1183508191 22:38220809-38220831 CTGTTGAAGCAGGGGCTTCTGGG - Exonic
1184175441 22:42786283-42786305 CCGTTGCAGTCGGAGCTGCATGG + Intergenic
1184651313 22:45920603-45920625 CTGTTGAAGCAGGAGGAGCCTGG + Exonic
1184750196 22:46481417-46481439 CAGTTGAAGCAGAAGCTGGAAGG - Intronic
1185253061 22:49815826-49815848 CATTGGAAGGAGGAGCTGCAGGG - Intronic
949509278 3:4754224-4754246 GGGCTGAAGCAGGAGTTGCAGGG - Intronic
950509477 3:13417164-13417186 GAGTTGGAGCAGGAGCTGCTGGG - Intronic
952713617 3:36455970-36455992 TTGTTGAGGCAGGGGCTGCAGGG - Intronic
954998018 3:54899827-54899849 CCGTTCATCCAGGAGCTGGATGG - Exonic
959040286 3:101414520-101414542 CAGGTGAAGCAGCAGCTGGACGG + Intronic
963156886 3:142108838-142108860 CCCTTGAGGCAGGAGGAGCACGG - Intronic
964672527 3:159242381-159242403 GAGTTGAAGCAGCAGCTCCATGG + Intronic
965342031 3:167503079-167503101 CAGCTGGAGCTGGAGCTGCACGG - Intronic
969244323 4:5922683-5922705 CCATGGATGCAGGAGCTGGAGGG - Intronic
977451705 4:97207130-97207152 GCTTTGAATCAGGAGCTGCCTGG + Intronic
978329807 4:107600175-107600197 CCGTTGCAGCAGGAGAGCCATGG + Intronic
978347776 4:107789146-107789168 CAGCTGCAGCAGGAGATGCATGG - Intergenic
981127570 4:141124044-141124066 ACCTTAAAGCAGGAGCTGAAGGG - Intronic
982297874 4:153848546-153848568 CAGTGGAAGAAGGAGCTGGAGGG - Intergenic
985697745 5:1350830-1350852 CCGTTGTAACAGGATTTGCATGG - Intergenic
987835782 5:23159588-23159610 ACCTTCAAGCAGGAGCTGAAGGG + Intergenic
995008501 5:107230554-107230576 CCGTGGAAGCACAAGCTGCTAGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
999412510 5:151364772-151364794 CAGTGGAAGCAGGAGCTCCAAGG + Intergenic
1000003632 5:157163473-157163495 CTGCTGAAGGAGGAGCAGCAAGG - Exonic
1000759901 5:165209638-165209660 CAGATGAAGCAGGAGATTCATGG + Intergenic
1001253465 5:170166302-170166324 CCGTAGCAGGAGGAGCTGCCAGG + Intergenic
1002305298 5:178279503-178279525 CAATTGAACCAGGCGCTGCAAGG - Intronic
1002701823 5:181130113-181130135 CAATGGGAGCAGGAGCTGCAGGG + Intergenic
1002717102 5:181234501-181234523 CCGCTGGAGCAGGGGCTGCTGGG - Exonic
1003083907 6:3045687-3045709 CAGGTGAAGCAGCAGCTGGACGG + Intergenic
1003606658 6:7567869-7567891 CTGTTCCAGCAGGTGCTGCAGGG - Exonic
1004013493 6:11711242-11711264 CCATAGAAACAGGAGCTGCAAGG + Intergenic
1004884570 6:20039231-20039253 CCGGTGAAGCCAGAGCTCCAAGG + Intergenic
1005490075 6:26339859-26339881 GTGTTGATGCAGGTGCTGCATGG - Intergenic
1010806587 6:80244191-80244213 CTGGTGAAGCAGGAGATGGAAGG + Intronic
1014752405 6:125269946-125269968 CTGGTGAAGCTGGTGCTGCAAGG + Intronic
1015888167 6:137942294-137942316 CCATTGGAGGAGGAACTGCAAGG - Intergenic
1017786563 6:157761760-157761782 CCGTGGAAGCAGGTGCAGGAAGG + Intronic
1018456714 6:163960137-163960159 ACGATGAAGCTGGGGCTGCAGGG - Intergenic
1018804812 6:167250222-167250244 CCCTGGAAGGAGGAGCCGCAGGG - Intergenic
1019180109 6:170181378-170181400 CAGGTGAAGCAGGAGCTCAAGGG - Intergenic
1019195709 6:170281540-170281562 CCGATGTAGCAGGAGCTGCGCGG - Intergenic
1019437541 7:1029769-1029791 CCGCTGAATAAGGATCTGCAAGG + Intronic
1019531150 7:1504128-1504150 GCGATGCTGCAGGAGCTGCAGGG + Intronic
1019648747 7:2144874-2144896 ACCTTGGAGCAGGAGCTTCATGG - Intronic
1020120792 7:5502115-5502137 CCGGTGGAGCAGCTGCTGCAAGG - Intronic
1021613374 7:22478912-22478934 CCGTGGAAGGAAGAGGTGCACGG + Intronic
1029403278 7:100358325-100358347 CGGCTGCAGCAGGAGCAGCAGGG - Exonic
1031539020 7:122970714-122970736 ACGGTGCAGCAGGAGCTGGAGGG - Intergenic
1034902950 7:154919004-154919026 ACCTTCAAGCAGGAGCTGAAGGG - Intergenic
1034960368 7:155360897-155360919 CCGTGAAAGGAGGGGCTGCAGGG + Intronic
1038688631 8:29741418-29741440 TTCTAGAAGCAGGAGCTGCATGG - Intergenic
1048508221 8:135039980-135040002 GCCTTGAAGGAGGATCTGCATGG - Intergenic
1049566991 8:143345472-143345494 GCGTGGCAGCAGGAGCTGGAGGG - Intronic
1051349180 9:16183038-16183060 TCTTTAAAGCAGAAGCTGCAGGG - Intergenic
1054324013 9:63704123-63704145 CCGGTGAAGGAGGAGCTTCGGGG + Intergenic
1059739074 9:117132172-117132194 CAGCAGAAGTAGGAGCTGCAAGG - Intronic
1061434837 9:130554655-130554677 CCATTGAGGCAGGGGATGCAGGG + Intergenic
1061582295 9:131545614-131545636 CCATGGAGGCAGGAGCTGGAGGG + Intergenic
1062426629 9:136509057-136509079 CCGTTGAAGCAGGAGCTGCAAGG + Exonic
1202790914 9_KI270719v1_random:89865-89887 CCGGTGAAGGAGGAGCTTCGGGG + Intergenic
1203563486 Un_KI270744v1:75656-75678 CAGTCAGAGCAGGAGCTGCAGGG + Intergenic
1185955833 X:4487960-4487982 ACCTTAAAGCAGGAGCTGAAGGG + Intergenic
1186384301 X:9093596-9093618 ACTTTAAAGCAGGAGCTGCAGGG - Intronic
1189653120 X:43211308-43211330 CCCTGCAAGCAGGTGCTGCAAGG - Intergenic
1191252822 X:58267520-58267542 CCGGTGTGGCAGGAGCTGCTGGG + Intergenic
1198313058 X:135438645-135438667 AAGTTGCAGCAGGAGCTTCAAGG + Intergenic
1199139207 X:144289982-144290004 CAGTTGAAGCTGGAGCAGCTGGG - Intergenic
1200742368 Y:6868142-6868164 CTGTGGCAGCAGGGGCTGCATGG + Exonic
1201159947 Y:11158838-11158860 CAGTCGGAGCGGGAGCTGCAGGG - Intergenic