ID: 1062426683

View in Genome Browser
Species Human (GRCh38)
Location 9:136509224-136509246
Sequence GCCGGGCCCCGGGTTCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062426683_1062426694 25 Left 1062426683 9:136509224-136509246 CCAGTGGGAACCCGGGGCCCGGC 0: 1
1: 0
2: 1
3: 18
4: 176
Right 1062426694 9:136509272-136509294 CCCTGCTTTCTTTATAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062426683 Original CRISPR GCCGGGCCCCGGGTTCCCAC TGG (reversed) Intronic
900157033 1:1207233-1207255 ACCGGGCCCTGGGTGCCCGCGGG - Intergenic
900417537 1:2542040-2542062 GCTGGGCCCTGGGTTTCCATGGG - Intergenic
900952644 1:5866440-5866462 GCAGGGCCCCGGGGAACCACGGG - Exonic
901018856 1:6245937-6245959 CGCGGGCGCCCGGTTCCCACCGG + Intergenic
901057417 1:6455142-6455164 GGCGGGCCCAGGGTGCCCAGGGG - Intronic
901456859 1:9368027-9368049 GCCCGGCCCAGGGTGCCCAGCGG + Exonic
901875993 1:12167341-12167363 GCCGGGCCCGGAGTCCCCAGCGG - Intronic
902649285 1:17826219-17826241 GCCGGGGCCCAGCATCCCACGGG + Exonic
903736663 1:25534319-25534341 GCCGGGCCTCTCCTTCCCACGGG + Intergenic
903750260 1:25616984-25617006 GCAGGGCGCGGGGCTCCCACTGG - Intergenic
903909149 1:26709493-26709515 CCAGGACCCCAGGTTCCCACTGG + Intronic
905169195 1:36099406-36099428 CCCGGGCCTCGGGGTCCCCCTGG - Exonic
905239429 1:36572263-36572285 GCCGGGCTCCAGGTTCCTATGGG - Intergenic
906731976 1:48090146-48090168 GCCGGGCCCTGGGTGGGCACAGG - Intergenic
907410899 1:54282614-54282636 GCCTGGCCCCGTGCTCACACAGG + Intronic
915301055 1:154951893-154951915 GCCGGGCCCAGTGTCTCCACTGG + Exonic
916218506 1:162419893-162419915 GCCGGACTCCGGGTACCCTCTGG + Intergenic
918069150 1:181122352-181122374 GCTGGGCCCCGGGTTTTCCCAGG + Intergenic
920315104 1:205071232-205071254 GCTGGGCCCCAGATTCCCCCGGG - Intronic
922720063 1:227895840-227895862 GCCGGGCCCCGGGTGCTGCCTGG - Intergenic
922763435 1:228146029-228146051 GCCGGGCCTCGGGTTCCTCGTGG - Exonic
923712700 1:236399861-236399883 CCCAGGCCCAGGGTTCCCCCAGG - Intronic
924778348 1:247126643-247126665 CCCGGGCCCCGGGCTCCCAGCGG + Intronic
924783310 1:247171777-247171799 CCCGGGCCCCGGGCTCCCAGCGG - Intronic
1065687780 10:28303020-28303042 GGCGGGGGCCGGGCTCCCACTGG - Intronic
1067083517 10:43226534-43226556 GACTGTCCCCGGGTTCCCTCAGG + Intronic
1070055665 10:72932409-72932431 GCTGTGCCCAGGGTTGCCACCGG + Exonic
1070800904 10:79243781-79243803 GCCGGGCCCTGGGCTCCCTCCGG + Intronic
1074358204 10:112804270-112804292 GCCAGGCTTCTGGTTCCCACAGG - Intronic
1076683711 10:132187423-132187445 GCCCGGCCCCGGGTTCTCCCCGG - Intronic
1077043858 11:535845-535867 GCAGGGCCCCGGGCTCTCCCGGG + Intronic
1077094997 11:795493-795515 GCCGGGGCCAGGGTGCCTACCGG + Intronic
1077408886 11:2394482-2394504 GCCAGGCCTGGGCTTCCCACAGG - Intronic
1081861041 11:46333402-46333424 GCCGTGCCCCGGGAACCCTCGGG - Intronic
1082783554 11:57304197-57304219 GCCAGGCCCCAGGTTCCCACTGG + Intronic
1083146086 11:60759938-60759960 GCCGGTCTCCGAGTTCCCTCAGG - Intronic
1083407951 11:62471776-62471798 GCCGGGATGCGGGTACCCACAGG + Intronic
1084422393 11:69066841-69066863 TCCGGGCCCGGGGCTCTCACTGG - Intronic
1090404146 11:126467184-126467206 GCGGGGCCCCAGGTTCTCTCTGG + Intronic
1094794100 12:33950695-33950717 GCCAGGCTCCCAGTTCCCACAGG - Intergenic
1095095365 12:38145007-38145029 GCCGGACTCGGGGTACCCACTGG + Intergenic
1096468908 12:51864230-51864252 GCCGTGCCCCGGGCTGCCCCTGG + Intergenic
1101037171 12:100717265-100717287 GCCGCGCTCCGGGTCCCCGCGGG - Intergenic
1101150372 12:101877726-101877748 GCCGGGCGCCGGGTTGCTCCGGG - Exonic
1102247138 12:111362777-111362799 GCCGGGCCTCGGCACCCCACGGG - Exonic
1103506145 12:121443342-121443364 GCTGGGCCGGGGATTCCCACAGG - Intronic
1103561558 12:121795620-121795642 GCCGGGCCCTGAGCTCCCTCAGG + Intronic
1104437234 12:128765870-128765892 GTGGGTCCCCTGGTTCCCACAGG - Intergenic
1107559622 13:41547516-41547538 TCAGGGCCCTGGGTTCCCACAGG - Intergenic
1112337668 13:98528068-98528090 GCTGACCCCTGGGTTCCCACTGG + Intronic
1112957175 13:105074003-105074025 GGGGGTACCCGGGTTCCCACAGG - Intergenic
1113632744 13:111899282-111899304 GGAGGGGCCCGGGTTGCCACTGG - Intergenic
1113632790 13:111899435-111899457 GGAGGGGCCCGGGTTGCCACTGG - Intergenic
1118318629 14:64740680-64740702 GCATGGCCCCAGGTTCCCAGGGG - Intronic
1118681394 14:68245374-68245396 TCGGGGCCCTGGGTTCCTACTGG + Intronic
1118767794 14:68921827-68921849 GCTGAGCCCTGGGTGCCCACAGG - Intronic
1118797169 14:69153504-69153526 GCCGGCCCGCGGGTCCCCGCGGG - Intergenic
1121014259 14:90538852-90538874 GCCGGGCCCCGGGTCACCGCTGG - Exonic
1122151243 14:99727243-99727265 GCCGGGCCCTGGGTGGGCACAGG - Exonic
1122921594 14:104882582-104882604 GCGGGGCCCTGGGCTGCCACAGG + Intronic
1123004483 14:105314770-105314792 GCCGGGCCCCGGCGTCGGACAGG - Exonic
1124042721 15:26119806-26119828 GCAGGACCCCGGGTGACCACGGG + Intergenic
1125719579 15:41838933-41838955 GCAGGGCCCTGGGTCCCTACTGG + Intronic
1129108005 15:73322519-73322541 GCCTGGCCCCAGGTTCCCTCTGG + Exonic
1129516356 15:76159990-76160012 GGCGGGCCCCGGGGTCCCAGAGG + Intronic
1130296327 15:82648788-82648810 ACCGGGCCCAGGCTTCCCTCCGG - Intronic
1130885734 15:88090906-88090928 GCCGTGCACCAGGTTCCCAGAGG - Intronic
1131095083 15:89649522-89649544 GAGGGGCTCCGGCTTCCCACTGG + Intronic
1132567011 16:628171-628193 ACCGGGGCCCTGGCTCCCACGGG + Exonic
1132785835 16:1656611-1656633 GCCCGGCCCCGGGCTCCTGCTGG + Exonic
1132994749 16:2817202-2817224 GCCGGGCCCGGGGCGCCCCCTGG - Intronic
1133287555 16:4697652-4697674 GCCCAGACCCGGGTCCCCACCGG - Intronic
1133350501 16:5097840-5097862 GCGGGGCCCGGGGGTCCCCCGGG + Intergenic
1134269889 16:12724090-12724112 TCCGGCCCCCAGGTTCCCTCTGG + Intronic
1139920177 16:70454784-70454806 GCGGTGCCCCGGGAGCCCACAGG + Intronic
1141828905 16:86498655-86498677 GGCGGGCCCCGGGTGCACCCCGG + Intergenic
1141841939 16:86579161-86579183 GCCGGGCCCCGGGGCCCCGGAGG + Exonic
1142022968 16:87795535-87795557 GCCGGGCCCTGGCTCGCCACTGG + Intergenic
1142120416 16:88383903-88383925 GCGGGGCGCCGCGTCCCCACGGG - Intergenic
1142509593 17:385640-385662 GCAGGGCCCGGGGCCCCCACGGG + Intronic
1142671954 17:1491580-1491602 CCCGCGCCCCGAGTACCCACCGG + Intronic
1148572136 17:48678574-48678596 GCCGGGCGCCGCCTTCCCTCGGG + Intergenic
1151724522 17:75876560-75876582 CCCTGACCCCGGCTTCCCACCGG + Intronic
1151833277 17:76568332-76568354 GCTGGTCCCCGGGTTCCTTCCGG + Intronic
1152068089 17:78122333-78122355 GCTGGCTCCCGGGTGCCCACGGG + Intronic
1152579986 17:81161617-81161639 GACGGCCCCCGGGTTCTCTCAGG + Intronic
1152739730 17:82013637-82013659 GCCGGCCCCCGGCTTCCGAGAGG + Intronic
1152793960 17:82297907-82297929 GCCTGGCCCCAGGTTCCTCCTGG + Intergenic
1154191118 18:12231699-12231721 GCCCGGCCCACGGTACCCACTGG + Intergenic
1160662319 19:306833-306855 GCCGGGCCCGGGGTGCCCTGAGG + Intronic
1160856462 19:1220140-1220162 GCAGGGCCCCGGATGTCCACAGG - Intronic
1161036510 19:2087973-2087995 GGTGGGCCCCTGGCTCCCACTGG - Intronic
1161282661 19:3454166-3454188 GGCGGGCACCGGGGTCCCCCAGG - Intronic
1161545482 19:4877944-4877966 GCCTGGCCCGGGGTCCCCTCGGG - Intergenic
1163292082 19:16385477-16385499 GCGTGGCCCCTGGGTCCCACTGG + Intronic
1163417424 19:17195143-17195165 GCCAGGCCTGGGGCTCCCACTGG - Exonic
1165886740 19:39084227-39084249 GCCAGGGCCCCGGGTCCCACAGG - Intronic
1165924885 19:39320797-39320819 GCCGGGCCCGGGGCCCCCCCGGG - Intergenic
1166960711 19:46494424-46494446 CCCGGGCCCAGGGGTCCGACGGG + Exonic
925068614 2:950099-950121 GCCGAGCGCCGGGTCCCCGCAGG + Intergenic
935234295 2:101125194-101125216 CCCTGGCCCCGGGTGCCCCCTGG - Intronic
935255774 2:101308495-101308517 CCCGGGCCCCGGGCACGCACAGG + Exonic
937715156 2:125024235-125024257 GCCGGACTCAGGGTACCCACTGG - Intergenic
937857187 2:126680929-126680951 GCCTTGCTCCAGGTTCCCACTGG - Intronic
939969698 2:148645126-148645148 GCCGTGCCCCAGATGCCCACCGG + Exonic
946421359 2:219566959-219566981 GCAGGGCCCCAGGTTCCACCTGG + Exonic
947669361 2:231926547-231926569 GCCGAGCCGCGGGATCCCTCCGG - Intergenic
948213910 2:236214866-236214888 GACAGGCCCTGGCTTCCCACAGG - Exonic
948563337 2:238868139-238868161 CCCGTGCCCTGGGTTCCCTCTGG + Intronic
948604023 2:239123430-239123452 GCCTGGCCCCTGCTGCCCACTGG - Intronic
1175265344 20:57699774-57699796 GCTTTGCCCCGGGTTCCCCCAGG - Intronic
1175579430 20:60087541-60087563 GCCGGGCCTCGGCTTCCCCGCGG - Intergenic
1175579445 20:60087588-60087610 GCCGGGCCTCGGCTTCCCCGCGG - Intergenic
1175579472 20:60087682-60087704 GCCGGGCCTCGGCTTCCCCGCGG - Intergenic
1175988810 20:62777455-62777477 GCAGAGCCCTGGGTTCGCACAGG + Intergenic
1176072608 20:63234920-63234942 GCAGGGCCGCTGGTTGCCACGGG - Intergenic
1176546726 21:8205515-8205537 GACGGTCCCCGGCTCCCCACGGG - Intergenic
1176554621 21:8249705-8249727 GACGGTCCCCGGCTCCCCACGGG - Intergenic
1176565677 21:8388562-8388584 GACGGTCCCCGGCTCCCCACGGG - Intergenic
1176573542 21:8432730-8432752 GACGGTCCCCGGCTCCCCACGGG - Intergenic
1176574176 21:8434891-8434913 GCCGGGCCCGGCGTTCCCAGCGG + Intergenic
1179627645 21:42657692-42657714 GCCTGGCCCAGGGGTCCCAAAGG - Intronic
1180055856 21:45358940-45358962 GCTATGCCCCGGGTTCCCAAAGG - Intergenic
1180871593 22:19149974-19149996 GCCGCGCCCCGGGCTCCGCCGGG + Intronic
1183409675 22:37647441-37647463 GCCGGGCCCCTGGCTCCTTCAGG - Exonic
1184565276 22:45288128-45288150 GCTGGGCCCCAGCTTTCCACTGG - Intronic
1184663370 22:45975752-45975774 GGCGGGGCCCGGGTCCCCGCAGG + Intronic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
1185039534 22:48497273-48497295 GCCGGGGCCTGCGGTCCCACGGG + Intronic
1185072689 22:48665995-48666017 GCCAGGCCCCTCGTTCCCATGGG - Intronic
1203251591 22_KI270733v1_random:121781-121803 GACGGTCCCCGGCTCCCCACGGG - Intergenic
1203259641 22_KI270733v1_random:166863-166885 GACGGTCCCCGGCTCCCCACGGG - Intergenic
1203260279 22_KI270733v1_random:169028-169050 GCCGGGCCCGGCGTTCCCAGCGG + Intergenic
954025845 3:47782288-47782310 GCCGGGCCCCGCTTTCCCTCAGG + Intergenic
954873100 3:53782808-53782830 GGAGGGCCCTGGCTTCCCACAGG + Intronic
959504579 3:107143469-107143491 GCCTGGACCCGGGTTAACACAGG + Intergenic
961393277 3:126569274-126569296 ACAGAGCCCCAGGTTCCCACAGG + Intergenic
965774114 3:172210149-172210171 GTAGGGCACAGGGTTCCCACCGG + Intronic
967694417 3:192514894-192514916 GCCGGCGCCCGGGCTCCCTCCGG - Intronic
968056588 3:195696773-195696795 CCCCTGCCCCGGGTCCCCACTGG - Intergenic
968092725 3:195908867-195908889 GCAGGCCCCCGGGGCCCCACCGG + Intronic
968690170 4:1986230-1986252 AACGGGCCCCGGGGTGCCACAGG + Intronic
968702106 4:2062109-2062131 GCCATGCCCCGTGTGCCCACCGG - Intronic
968916477 4:3499095-3499117 GCCGGGCAGCGGGTGGCCACAGG + Intronic
969492739 4:7509372-7509394 GCCTGGCCCAGGACTCCCACCGG - Intronic
969595686 4:8148212-8148234 GCCTGGCCCAGGGCCCCCACAGG - Intronic
969680513 4:8640634-8640656 GCCAGGCCCCGTGTTCCACCAGG + Intergenic
976306545 4:83565695-83565717 GCCGGACTCGGGGTACCCACCGG - Intronic
976398702 4:84583682-84583704 GTCGGGACCCGGGATCCCAGTGG + Intronic
985471732 5:50936-50958 GCCGGGCCCCGGGCATCCCCAGG - Intergenic
992747240 5:79831712-79831734 GCTGGGCCCCGCCTCCCCACAGG + Intergenic
997692306 5:135835028-135835050 GCCCGGCCCCGAGATCCCCCTGG + Intronic
998332189 5:141339037-141339059 GCCCGGCCCTGGCCTCCCACAGG - Exonic
998364302 5:141618882-141618904 GCCGGGCCCCAGGCTCCCGCCGG + Exonic
998622585 5:143811416-143811438 GCCGGGTCCTGTGTTCCCATGGG - Intergenic
1003324908 6:5084495-5084517 TCCGCGCCCCGGGATCCCGCAGG - Intergenic
1005627834 6:27680216-27680238 GTCGCGCCCCGAATTCCCACTGG + Intergenic
1012052440 6:94361960-94361982 GCGGGGCCCCAGGTTCTCTCTGG + Intergenic
1018712271 6:166505655-166505677 GCCGGGCACCCGCTTCACACAGG + Intronic
1019381662 7:727313-727335 GCGGGGCCCGGGGTGCTCACCGG - Exonic
1019389255 7:776547-776569 GCCCGGCCCCGTCTCCCCACAGG - Intronic
1029600252 7:101559112-101559134 GCCAGGCCCGGGGTGACCACAGG + Intergenic
1033102214 7:138483783-138483805 GGGGTGCCCCTGGTTCCCACAGG + Intronic
1033328369 7:140398160-140398182 GCCGGGCCGCAGGGTCCCCCGGG + Intronic
1034456278 7:151172685-151172707 GCCTGGCCGCGGGTGCCCTCTGG + Intronic
1034543740 7:151776567-151776589 CCCAGGCCCCGGGTACACACGGG + Intronic
1035435449 7:158856310-158856332 AACCCGCCCCGGGTTCCCACGGG - Intergenic
1035607378 8:938795-938817 GCCGAGACCTGGGTTCCCTCTGG - Intergenic
1036176887 8:6547780-6547802 CCCTGGCCCCGCATTCCCACCGG - Intronic
1049378030 8:142298299-142298321 TCCTGGCCCCGGGTTCCCTCTGG - Intronic
1049398952 8:142416295-142416317 GCGGGTCCCCGGCTTCCCCCAGG - Intergenic
1049576691 8:143392990-143393012 GCCTGGCTCCGGGGTCCCAGAGG + Intergenic
1049603772 8:143519869-143519891 GCTGGGCCGTGGCTTCCCACAGG - Intronic
1053783131 9:41631194-41631216 CCTGGGCCCCAGGTTGCCACAGG - Intergenic
1054171084 9:61841336-61841358 CCTGGGCCCCAGGTTGCCACAGG - Intergenic
1054349912 9:64012187-64012209 GCTGGGGCCTGGGTACCCACTGG - Intergenic
1054666449 9:67739476-67739498 CCTGGGCCCCAGGTTGCCACAGG + Intergenic
1055574634 9:77648571-77648593 GCCAGGCACCGGGTTCCGACAGG + Intergenic
1058937130 9:109780009-109780031 CCCGCGCCCCAGGTGCCCACTGG + Intronic
1059102262 9:111483110-111483132 GCCTGGCCCCGGGTCCCCGACGG - Intronic
1059283000 9:113150833-113150855 GCCTCGCCCCAGGTTCCCAAGGG - Intergenic
1059416852 9:114167793-114167815 GCCCGGCTCCAGGCTCCCACGGG + Exonic
1060514632 9:124258112-124258134 TCCGGGCCGCGGGGCCCCACCGG - Intronic
1061149101 9:128818847-128818869 CCCGGGCCGCGGGGTCCCCCGGG - Exonic
1061802775 9:133121236-133121258 GCCGGGCCGCGGGCTCACAGCGG - Intronic
1061934661 9:133850679-133850701 GCAGGGCCCCGTGAGCCCACTGG + Intronic
1062081010 9:134623410-134623432 GCCTGGCCCCGGGTTTCTACAGG - Intergenic
1062179138 9:135181288-135181310 GCCAGCCCTCGGCTTCCCACAGG - Intergenic
1062398211 9:136361113-136361135 GCCGCGCCCCGGCCTCCCACGGG + Intronic
1062426683 9:136509224-136509246 GCCGGGCCCCGGGTTCCCACTGG - Intronic
1062601193 9:137319319-137319341 GCCGGGCCCCGGGACCACGCAGG - Intronic
1203738770 Un_GL000216v2:161214-161236 CCCCGGCCCCGGGCTTCCACTGG - Intergenic
1203467993 Un_GL000220v1:104932-104954 GACGGTCCCCGGCTCCCCACGGG - Intergenic
1203468627 Un_GL000220v1:107093-107115 GCCGGGCCCGGCGTTCCCAGCGG + Intergenic
1203475814 Un_GL000220v1:148904-148926 GACGGTCCCCGGCTCCCCACGGG - Intergenic
1203476448 Un_GL000220v1:151065-151087 GCCGGGCCCGGCGTTCCCAGCGG + Intergenic