ID: 1062426859

View in Genome Browser
Species Human (GRCh38)
Location 9:136510139-136510161
Sequence AGACCCCAAGCACAGGAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 199}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062426859_1062426871 18 Left 1062426859 9:136510139-136510161 CCCGTCTCCTGTGCTTGGGGTCT 0: 1
1: 0
2: 1
3: 29
4: 199
Right 1062426871 9:136510180-136510202 GTCCTCAAGCTCCAGGGCAGGGG No data
1062426859_1062426867 12 Left 1062426859 9:136510139-136510161 CCCGTCTCCTGTGCTTGGGGTCT 0: 1
1: 0
2: 1
3: 29
4: 199
Right 1062426867 9:136510174-136510196 GCTCCTGTCCTCAAGCTCCAGGG No data
1062426859_1062426872 19 Left 1062426859 9:136510139-136510161 CCCGTCTCCTGTGCTTGGGGTCT 0: 1
1: 0
2: 1
3: 29
4: 199
Right 1062426872 9:136510181-136510203 TCCTCAAGCTCCAGGGCAGGGGG No data
1062426859_1062426870 17 Left 1062426859 9:136510139-136510161 CCCGTCTCCTGTGCTTGGGGTCT 0: 1
1: 0
2: 1
3: 29
4: 199
Right 1062426870 9:136510179-136510201 TGTCCTCAAGCTCCAGGGCAGGG No data
1062426859_1062426866 11 Left 1062426859 9:136510139-136510161 CCCGTCTCCTGTGCTTGGGGTCT 0: 1
1: 0
2: 1
3: 29
4: 199
Right 1062426866 9:136510173-136510195 TGCTCCTGTCCTCAAGCTCCAGG No data
1062426859_1062426869 16 Left 1062426859 9:136510139-136510161 CCCGTCTCCTGTGCTTGGGGTCT 0: 1
1: 0
2: 1
3: 29
4: 199
Right 1062426869 9:136510178-136510200 CTGTCCTCAAGCTCCAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062426859 Original CRISPR AGACCCCAAGCACAGGAGAC GGG (reversed) Intronic
902192958 1:14776413-14776435 AGATCCCAAGGACAGGGGTCTGG - Intronic
902433879 1:16384568-16384590 AGACCCCTTGCAGGGGAGACTGG + Intronic
902791456 1:18771281-18771303 TGATGCCAAGCACAGGAGGCAGG + Intergenic
903342423 1:22662711-22662733 AGGCCCCAGGCCCAGGAGATAGG - Intergenic
904570170 1:31458358-31458380 AGACTCCAAGCAATGGAGATAGG + Intergenic
906035715 1:42749184-42749206 AGAGCACAAGCACAGGTGCCAGG - Intronic
907368054 1:53978956-53978978 GGACTCCAAGCAGGGGAGACAGG + Intergenic
907429431 1:54403669-54403691 AGATCCCAACGACAGGAGACAGG + Intronic
908774693 1:67628470-67628492 TGATCCCAAGAACAGGAGAGAGG - Intergenic
910217566 1:84857761-84857783 AGATTCCAACCCCAGGAGACTGG - Intronic
911288664 1:96028639-96028661 AAACCCCGAACACAGGAGACTGG - Intergenic
912794909 1:112687278-112687300 TCACCCCAAGCAAATGAGACTGG - Intronic
915065598 1:153221836-153221858 TGACCGCAAGCTCAGGAGACAGG + Intergenic
918111154 1:181456474-181456496 AGACACCAAGCAAAGGAGGTGGG - Intronic
923241151 1:232086974-232086996 AGACCCCTATAACAGAAGACAGG + Intergenic
924643851 1:245858751-245858773 AGCTCCCAAGCACAGGAGCGAGG + Intronic
924770895 1:247078600-247078622 GGACCCCAGACACCGGAGACTGG - Exonic
1066295621 10:34051699-34051721 AAACCCCAAGCACAGAAGGAGGG + Intergenic
1066668982 10:37816983-37817005 AGACCCCATTCACATGACACAGG - Intronic
1068542086 10:58306176-58306198 AGACACCAAGCACAGAAGCAAGG + Intergenic
1071366494 10:84905761-84905783 TGAGCCCAGGAACAGGAGACTGG + Intergenic
1072015261 10:91340716-91340738 AGACCACAAGGTCAGGAAACAGG - Intergenic
1074165507 10:110871246-110871268 AGAACCCCAGCACTGGAGGCCGG + Intergenic
1075184463 10:120243106-120243128 AGACCCTGAGCACAGGGGTCGGG - Intergenic
1075639833 10:124056656-124056678 TGGCCCCATGCACAGGAGGCAGG + Intronic
1075882271 10:125863669-125863691 AGATCCCAAGGTCAGGAGATCGG - Intronic
1076130766 10:128012196-128012218 AGAGCCCCAACACAGGAGACAGG - Intronic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1077217933 11:1402807-1402829 AGGCCCCCAGCAGAGGAGGCGGG + Intronic
1077258917 11:1604983-1605005 ACACCCCAGGCACAGGGGACAGG - Intergenic
1077317228 11:1924996-1925018 AGGCCGCAAGGACAGGAGGCCGG - Intronic
1077426944 11:2485024-2485046 AGACGCCATGCACAGGCGCCAGG - Intronic
1078395313 11:10976248-10976270 AGACTCCTTGCAGAGGAGACAGG + Intergenic
1078509509 11:11975207-11975229 AGATCCGAAACAGAGGAGACTGG - Intronic
1079401783 11:20111754-20111776 AGAACCCAAGGCCAAGAGACGGG - Intronic
1080718776 11:34829369-34829391 AGACACCAAGGAGAGGAGCCTGG - Intergenic
1081557781 11:44182169-44182191 AGACCCCAGGCACAGAAAGCAGG - Intronic
1088914856 11:114219827-114219849 AGACCCCAAGCCCAACAGACTGG - Intronic
1089662146 11:119992716-119992738 AGACACTAAGCCCACGAGACAGG - Intergenic
1090226620 11:125075783-125075805 AGAGCCCAAGGGCAGGACACTGG - Intronic
1092283276 12:7113624-7113646 AGAGCCCAGGCAGAGGAGTCTGG + Intergenic
1092783975 12:12011439-12011461 AGCCCCCAAGGAGAGGTGACTGG + Intergenic
1094830745 12:34299045-34299067 AGACCCCATGCACAGGCTGCTGG - Intergenic
1096810521 12:54166756-54166778 TGACCTCAGGCACAGGGGACAGG + Intronic
1100832131 12:98526302-98526324 CCACCCCAAGGATAGGAGACAGG - Intronic
1101228650 12:102715933-102715955 GGTCCCCAAGCCCTGGAGACTGG - Intergenic
1101642902 12:106601356-106601378 AGGGCCCAGGGACAGGAGACTGG + Intronic
1101714756 12:107300995-107301017 CAACCCCAAGCTCAGGAGATTGG - Intergenic
1102873077 12:116428952-116428974 GGACCCCAAGCCCAGGAGAGGGG - Intergenic
1103199862 12:119079022-119079044 AGACCAAAAGCACAGGAGAAGGG + Intronic
1103963930 12:124626250-124626272 AGCCTCCAAGTCCAGGAGACAGG - Intergenic
1104232644 12:126900115-126900137 AGACCCTCCTCACAGGAGACCGG - Intergenic
1104363266 12:128153644-128153666 AGACTCGGAGCACAGGAGATAGG + Intergenic
1106000645 13:25719931-25719953 TGTCTCCAAGCACAGGACACAGG - Intronic
1106786079 13:33109286-33109308 AAACCCCAAGAACAGGGGTCTGG + Intronic
1109560796 13:64047644-64047666 AGACACCAAGCAGCGGACACAGG + Intergenic
1111175524 13:84590634-84590656 AGGACCCATGCCCAGGAGACAGG + Intergenic
1112378442 13:98865711-98865733 AGTCCCCAGGTACAGGAGACTGG + Intronic
1113035205 13:106040475-106040497 AGATCCCACGCTCAGGAGACAGG + Intergenic
1113567619 13:111328364-111328386 AGACCCCGAGGAAGGGAGACAGG - Intronic
1113884082 13:113648360-113648382 GGGCCCCAAGCACAAGCGACTGG - Intergenic
1116896590 14:50321323-50321345 AAACCCCAAGAACAAGAAACAGG + Intronic
1117312063 14:54536328-54536350 AATGTCCAAGCACAGGAGACTGG - Intronic
1118273129 14:64362088-64362110 AGACCCCAAGAGCAGGTTACTGG - Intergenic
1120885343 14:89447629-89447651 ACACCCCATGCCTAGGAGACCGG + Intronic
1121319377 14:92982076-92982098 AGACACCCAGCACAGGTGACAGG + Intronic
1122983689 14:105202724-105202746 AGACCCCAGGCAGAGGAGGCTGG + Intergenic
1124631954 15:31343060-31343082 TCTCCCCAAGCACAGGAGCCTGG - Intronic
1125538799 15:40458156-40458178 AGACCCCAGGGACAGGGGATAGG - Intronic
1128768947 15:70267552-70267574 AGAGCCCAGGCAGAGGGGACAGG - Intergenic
1132226955 15:100150306-100150328 AGACCCCAAAGAGAGGAGGCAGG - Intronic
1132408052 15:101556529-101556551 GTACCTCACGCACAGGAGACCGG - Intergenic
1134878444 16:17723235-17723257 AGAACCCAAGGACAAGAAACTGG - Intergenic
1135260645 16:20977574-20977596 AGACCACAAGCACAGCAGGCTGG + Intronic
1135293795 16:21262214-21262236 AAGCCCAAAGCACAGGAGAGAGG + Intronic
1135715213 16:24758871-24758893 AGACCCCAAGCAAAAGACATCGG + Intronic
1135735332 16:24926861-24926883 AGGACCCAAACACAGGAGACTGG - Intronic
1137793892 16:51198579-51198601 AGACCCCAAACAAAAGACACAGG - Intergenic
1140749433 16:78009823-78009845 AGACAGCAAGTCCAGGAGACAGG - Intergenic
1142203343 16:88771441-88771463 AGGCCCCAAGCCCAGCAGGCAGG + Intronic
1142308620 16:89299521-89299543 AGACCCCAAGCACCCCACACAGG - Intronic
1142376515 16:89709567-89709589 AGACCCCAGGCACGGGAGAGTGG + Intronic
1143289872 17:5820502-5820524 AGACCCCAAGAAGAGCAGGCAGG - Intronic
1143964685 17:10748686-10748708 AGAAGCCAGGCACAGGAGCCTGG + Intergenic
1143982334 17:10880687-10880709 ACAGTCCAAGCACAGGATACTGG + Intergenic
1144074198 17:11702143-11702165 AGAGCCCAGGCTCAGAAGACAGG + Intronic
1144094742 17:11889868-11889890 AGACCCCATGGGCAGGAGAAGGG + Intronic
1144826061 17:18106343-18106365 ACACCCAAAGCTCAGGACACAGG - Intronic
1145270245 17:21401066-21401088 AGAGCCCAAGGACAGAAGCCAGG - Intronic
1146470735 17:33122228-33122250 AGTTCCCAGGCACAGCAGACTGG + Intronic
1148904071 17:50900492-50900514 AGAATCCAAGGACAGGAAACAGG - Intergenic
1151706700 17:75772978-75773000 AGCCCCCAAGCACAGCTGGCTGG - Intergenic
1151999624 17:77637267-77637289 AGACCCCATGCCCTGGAGAGAGG - Intergenic
1152560298 17:81075307-81075329 AGACCAGAAGCACAGGGGAAGGG - Intronic
1152739180 17:82011631-82011653 AGGCCCCGAGCACTGGAGGCAGG - Intronic
1153362294 18:4210936-4210958 TGACCTCAAGGTCAGGAGACAGG - Intronic
1153903202 18:9637155-9637177 ACACCCCAGGCACAGGCTACGGG - Intergenic
1156939709 18:42752593-42752615 AGAATCCTAGCACAGGAGACTGG - Intronic
1158448019 18:57537879-57537901 ACTCCCCAAGCACAAGAGTCAGG + Intergenic
1158886669 18:61834555-61834577 AGACCCCAAGGACAGGGATCTGG + Intronic
1159940189 18:74400844-74400866 AGCACCCAAGAACAGGAAACTGG + Intergenic
1160142709 18:76339573-76339595 AGAACCCAAGCACAGGTCCCTGG - Intergenic
1160234983 18:77078737-77078759 AGAGCCCCAGCACAGGGCACGGG - Intronic
1160241252 18:77124644-77124666 AGAGCCCACCCACAGGAGATAGG + Intronic
1160508185 18:79438787-79438809 ATACCCCAAGCTCAGGACGCAGG + Intronic
1160708682 19:540932-540954 AGGGCCCAAGGACAGGAGGCAGG - Intronic
1160806607 19:994846-994868 AGACCCCCTGCACAGCAGACCGG - Intronic
1161805602 19:6441477-6441499 ACACCCCAACCACAGGAGCACGG - Exonic
1162011416 19:7817833-7817855 AGACCCCAGGCAAAGGATCCAGG - Intergenic
1164090004 19:21941120-21941142 AGACGCCAAGAACAGAAGAACGG + Intronic
1164488296 19:28681379-28681401 AGACCAGAAGGACAGGACACAGG + Intergenic
1164523086 19:28993732-28993754 ATACACCAAACAAAGGAGACAGG - Intergenic
1164725762 19:30464741-30464763 AGAGCCTGAGCACAGGAGAAAGG + Intronic
1164772538 19:30821193-30821215 AGACCCAAAGACCAGGAGACAGG - Intergenic
1166339851 19:42131002-42131024 AGGCCCCAAGCAGAGGGGTCAGG - Intronic
1167690561 19:50982122-50982144 AGACCCTGAGCACAGGAGGCAGG + Intronic
925234845 2:2269053-2269075 GCACCCCACACACAGGAGACTGG - Intronic
926927010 2:17996937-17996959 AGACCCAAAGCACACCAGATTGG - Intronic
927518470 2:23685697-23685719 AGAGCCCAAGCACCGGGGGCAGG - Intronic
927895302 2:26777978-26778000 AGACCCCCAGCACAGCCCACCGG - Intronic
929546200 2:42856572-42856594 AGACCCCAAACAGAGGAAATGGG - Intergenic
932796557 2:74700852-74700874 AGACCTCAAGCACAAGAACCAGG - Intergenic
933170842 2:79122938-79122960 TGACCTCAAGCACAGGTGAGAGG + Exonic
936078843 2:109418683-109418705 AGACCACAAGCACTGGTGCCAGG + Intronic
938169222 2:129059891-129059913 AGGCTCCCAGCACAGGAGACTGG - Intergenic
938392269 2:130915668-130915690 AGACCCCAACTACAGGGAACAGG + Intronic
938404117 2:131018628-131018650 AGACCAAAAGCACAGGCAACAGG - Intronic
939840088 2:147176310-147176332 AGAACACAAGCACAGGTGAATGG - Intergenic
941863161 2:170306123-170306145 AGACCACAAGCATAGGAAGCGGG - Intronic
946024796 2:216665285-216665307 AGACTCCAGCCACAGGAGAGGGG - Intergenic
1169132400 20:3173109-3173131 AGACCCCAGCCACAGGCCACAGG + Intronic
1169140156 20:3223244-3223266 AGACCCCAAGGAAAGGGGAGTGG - Intronic
1169488258 20:6051570-6051592 GAACACCAAGAACAGGAGACCGG + Intronic
1176284706 21:5013254-5013276 ACACCTCAGCCACAGGAGACAGG + Intergenic
1176980162 21:15372546-15372568 AGATACCAAGCAAAGCAGACTGG + Intergenic
1178875930 21:36413862-36413884 AGCCCCCAAGGACAGGAAGCAGG + Intronic
1179016328 21:37596955-37596977 ATACACCAAACAAAGGAGACGGG - Intergenic
1179501191 21:41810042-41810064 AGACCCCCAGTACTGGAGGCAGG - Intronic
1179541345 21:42085132-42085154 AGACATCTACCACAGGAGACGGG - Intronic
1179872475 21:44250221-44250243 ACACCTCAGCCACAGGAGACAGG - Intronic
1181171766 22:21014035-21014057 AGCCCCCAAGGGGAGGAGACGGG + Intronic
1181774383 22:25148992-25149014 AGACACCAAGCCCAAGAGGCAGG - Intronic
1182046311 22:27276913-27276935 AGACCACATGCAGAGGAGAAGGG + Intergenic
1183227983 22:36563388-36563410 TGACCCCAAGGACAGGAGCTTGG + Intergenic
1183448704 22:37878177-37878199 AGACCCCAAGCCCAGGGGACAGG - Intronic
1183500867 22:38178126-38178148 AGCTCCCAAGCACATGAGACAGG + Intronic
1183991300 22:41598685-41598707 AGACCCCAGGCAGAGGGGTCTGG + Exonic
1184091234 22:42294073-42294095 AGAGCCCTAGGACAGGAGCCAGG + Intronic
1185279456 22:49963741-49963763 AGACGCCAGGCACAGGAATCAGG - Exonic
951132546 3:19065239-19065261 AGCCCCCAACCACAGAACACAGG + Intergenic
951946748 3:28146331-28146353 AAACACCAGGCACAGCAGACAGG - Intergenic
952837011 3:37611624-37611646 AGCCCCCAAGCTGAGAAGACAGG + Intronic
953905663 3:46867206-46867228 AGACCCCAGACACAGGAACCAGG + Intronic
954596710 3:51831117-51831139 TGATTCCAAGCTCAGGAGACAGG - Intergenic
958690879 3:97464626-97464648 AGTCCCCCACCACAGGATACTGG + Intronic
960366739 3:116782004-116782026 AGCCCCCCAGCACTGGAAACTGG - Intronic
961404396 3:126668065-126668087 AGTCCCCAGGCACTGGGGACAGG - Intergenic
961642547 3:128373731-128373753 CCACCCCAAGGACAGGAGACTGG - Intronic
961820914 3:129575283-129575305 AGACCCCAAGGCCTGGAGCCTGG + Intronic
962842539 3:139248951-139248973 AAACACCAAGGACAAGAGACAGG - Intronic
963926928 3:150960735-150960757 AGAGCCCTTCCACAGGAGACAGG + Intronic
965479286 3:169197419-169197441 AGACACCAACCAAAGTAGACTGG - Intronic
965575166 3:170210532-170210554 AGACAACAAGCCCTGGAGACAGG + Intergenic
966902843 3:184499649-184499671 AGCCCCCAAGCCCAGGTGCCAGG + Intronic
966933476 3:184690728-184690750 AGAGCCCGGGCAGAGGAGACTGG - Intergenic
968466713 4:755312-755334 ACACCCCACACACAGGAGACTGG - Intronic
975680821 4:76874206-76874228 ATACCACCAGCAGAGGAGACAGG + Intergenic
976184942 4:82434200-82434222 AACCACCAAGCAAAGGAGACAGG - Intronic
977193760 4:94032882-94032904 AGACACTAAGCATAGTAGACAGG - Intergenic
978034231 4:103974514-103974536 AGACCCCAAGGAAAGTTGACAGG - Intergenic
981121502 4:141056574-141056596 AGGCCTCAAGCAGAGGAGAAAGG - Intronic
983157396 4:164367075-164367097 AGGGCCCAAGCACCGGAGAGAGG + Intronic
985571290 5:646876-646898 GGACCCCAAACACAAGAGGCTGG - Intronic
985677849 5:1241502-1241524 TGCTCCCAAGCACAGGAGGCTGG - Intronic
985844764 5:2335968-2335990 AGTCCACAAGCCCAGGAGAGAGG - Intergenic
988968023 5:36439521-36439543 AGTCCCCAAGCACAGAAGCTGGG + Intergenic
993335110 5:86647218-86647240 AGACCCAGAGCACAGGAAAATGG + Intergenic
993966551 5:94366825-94366847 GTACCCCAAACAAAGGAGACAGG + Intronic
994095162 5:95841392-95841414 AAACTCCAATAACAGGAGACTGG - Intergenic
997628814 5:135350679-135350701 ACAACCCAGGGACAGGAGACAGG + Intronic
1001552164 5:172610980-172611002 TCTCCCCAAGCACAGGAGGCTGG - Intergenic
1002436749 5:179236185-179236207 AGACCCCAAACACAGCACAGAGG - Intronic
1002669326 5:180853178-180853200 AATCTCCAAGCACAGAAGACTGG + Intronic
1003132743 6:3409432-3409454 TGACCACACGCACAGGAGTCAGG - Intronic
1003136486 6:3438492-3438514 AGACACCAAGCGCTGGAGGCCGG - Intronic
1003548683 6:7083111-7083133 AAACCCCAAGCAGTGGAGACTGG - Intergenic
1004052481 6:12099617-12099639 AGACCCCAGGCAGAGGTGAGAGG - Intronic
1007366558 6:41398186-41398208 AGACCCCAAAGACAGGAGAAGGG + Intergenic
1009376826 6:62981764-62981786 AAAACCCAAGCACAAGAAACAGG + Intergenic
1016352059 6:143178544-143178566 AGACCTCAAGCACAGGAAAAAGG - Intronic
1017553820 6:155541636-155541658 AGACCCAAAGCCCAGCAGACAGG - Intergenic
1017743750 6:157428643-157428665 AGCCCCCGAGCACAGGTGGCTGG + Intronic
1019529848 7:1497905-1497927 GGACCCAATGCACAGGAGGCGGG + Intronic
1019711620 7:2520548-2520570 CAACCCCAAGCACTGGAGACTGG - Intronic
1022205920 7:28163519-28163541 AGAACACAAGTACAGAAGACTGG + Intronic
1022548540 7:31212565-31212587 AGATCCGTAGCACAGGAGTCAGG + Intergenic
1024204326 7:47143127-47143149 AGAACCCAGGCACTGGAGTCAGG - Intergenic
1024526336 7:50353157-50353179 ACAGCCCAGGCACAGGAGGCAGG + Intronic
1028809321 7:95066231-95066253 AGACCGCAAGCCTAGGAGAGAGG + Intronic
1029193794 7:98790195-98790217 AGCCACCATGCTCAGGAGACAGG - Intergenic
1030550691 7:110955512-110955534 AGACCCCAAGCAGTAAAGACAGG + Intronic
1032648519 7:133852731-133852753 CCACCCCAAGGACAGGAGTCAGG - Intronic
1033353687 7:140582675-140582697 GGCCATCAAGCACAGGAGACAGG + Intronic
1034182275 7:149147887-149147909 AGCCGCCAAGCACGGGCGACAGG - Intronic
1035302686 7:157907557-157907579 ACACCTCACACACAGGAGACAGG - Intronic
1036122801 8:6036379-6036401 TCACCCCAAGCACAGAAGGCAGG + Intergenic
1037029346 8:14083660-14083682 AGACCCCAGGCACAAGTGATAGG - Intergenic
1038435874 8:27535699-27535721 AGACACCAAGAACAGGGGAATGG - Intronic
1040487139 8:47884225-47884247 AGACCCCCAGCAGCAGAGACAGG + Intronic
1041734543 8:61095712-61095734 AGACCCCAAGCATAGGGATCAGG + Intronic
1043436282 8:80238851-80238873 ATACCCCAAGCAAAGGAAGCAGG + Intergenic
1045186280 8:99841766-99841788 AGACCCCAGTCACAGAAGAAAGG - Intronic
1047964585 8:130036470-130036492 TAACCCCAAACTCAGGAGACTGG - Intergenic
1049683056 8:143928244-143928266 AGACCCCAAGGCCCCGAGACAGG + Intronic
1050044759 9:1531353-1531375 AGTCCTCAAGCACAGGAGGAAGG + Intergenic
1052960520 9:34292456-34292478 AGAACGCAAGCCCAGGAGACAGG - Intronic
1057022863 9:91714280-91714302 AGCCCGCGAGCACAGCAGACAGG + Intronic
1057730529 9:97604539-97604561 AGAACCCTAGCCCAGGAGTCAGG - Intronic
1060438294 9:123615340-123615362 AGAACCCAAGCCCATGATACGGG + Intronic
1061282766 9:129607019-129607041 GGACCCCAAGCACGGCAGCCGGG - Intergenic
1062117467 9:134817142-134817164 AGGGCCCAAGCAAAGGTGACGGG - Intronic
1062426859 9:136510139-136510161 AGACCCCAAGCACAGGAGACGGG - Intronic
1185609962 X:1388412-1388434 AGTCTCCAAGCCCAGGAGAGAGG + Intronic
1187688812 X:21842976-21842998 AGACCCTAATCTCAGTAGACCGG + Intronic
1188860020 X:35244767-35244789 AGACCCCAGGCCCAGCAGTCAGG + Intergenic
1189796592 X:44651607-44651629 AGCCACCAAGCAAAGGAAACTGG + Intergenic
1191258549 X:58290435-58290457 AGACCCCAGGGGAAGGAGACAGG + Intergenic
1195002258 X:100653165-100653187 AGTCCACCAGCTCAGGAGACAGG - Intronic
1199321045 X:146439870-146439892 AGACCCCAAATATATGAGACAGG + Intergenic
1199637728 X:149829470-149829492 ATACACCAAACAAAGGAGACAGG - Intergenic