ID: 1062427597

View in Genome Browser
Species Human (GRCh38)
Location 9:136513020-136513042
Sequence AACTGCCTGCTGCCCTACAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062427597_1062427602 28 Left 1062427597 9:136513020-136513042 CCTGTGTAGGGCAGCAGGCAGTT 0: 1
1: 0
2: 0
3: 13
4: 131
Right 1062427602 9:136513071-136513093 CACGTGCCCTGGTTCAGACATGG 0: 1
1: 0
2: 0
3: 8
4: 110
1062427597_1062427598 -9 Left 1062427597 9:136513020-136513042 CCTGTGTAGGGCAGCAGGCAGTT 0: 1
1: 0
2: 0
3: 13
4: 131
Right 1062427598 9:136513034-136513056 CAGGCAGTTGCACTTGTACCCGG 0: 1
1: 0
2: 0
3: 5
4: 140
1062427597_1062427601 17 Left 1062427597 9:136513020-136513042 CCTGTGTAGGGCAGCAGGCAGTT 0: 1
1: 0
2: 0
3: 13
4: 131
Right 1062427601 9:136513060-136513082 CGTCGTCAATACACGTGCCCTGG 0: 1
1: 0
2: 0
3: 0
4: 18
1062427597_1062427603 29 Left 1062427597 9:136513020-136513042 CCTGTGTAGGGCAGCAGGCAGTT 0: 1
1: 0
2: 0
3: 13
4: 131
Right 1062427603 9:136513072-136513094 ACGTGCCCTGGTTCAGACATGGG 0: 1
1: 0
2: 0
3: 6
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062427597 Original CRISPR AACTGCCTGCTGCCCTACAC AGG (reversed) Exonic
900373354 1:2342258-2342280 TGCTGCCTGGTGCCCTACACAGG - Intronic
909254659 1:73404559-73404581 AACTTCATGCAGCACTACACTGG - Intergenic
910698917 1:90051037-90051059 AAATGCCTGCTGCCCCTCTCAGG + Intergenic
913373678 1:118128687-118128709 AACTTCCTGCACCCCAACACTGG + Intronic
913554423 1:119950723-119950745 CACTGTGTGCTGCCATACACAGG - Exonic
914720946 1:150288362-150288384 AGAAGCCTGATGCCCTACACAGG - Intergenic
915596363 1:156898526-156898548 AGCAGCCTGCTGCACTCCACAGG - Intronic
915635079 1:157180754-157180776 AACTCCCTGCTGGCAGACACTGG - Intergenic
918406891 1:184220334-184220356 AAGTGCCCTCTGCCCTTCACTGG - Intergenic
922292929 1:224223796-224223818 AACTCCATGCTGCCCTTCCCGGG - Intergenic
922333045 1:224594559-224594581 TTCTGCCTCCTGACCTACACTGG - Intronic
924085935 1:240451586-240451608 AACTGCCTGCTCCCCAACAGGGG + Intronic
1064160910 10:12945193-12945215 AACTGCTTGCTTCCTTTCACTGG + Intronic
1065679618 10:28215374-28215396 ATCTGGCTGCTACCCTACACTGG - Intronic
1066516803 10:36171507-36171529 AACTGCCTGCTGCCGGTCAGTGG - Intergenic
1072466408 10:95666620-95666642 AAATGCCTGGTGACCTATACTGG + Intronic
1075207499 10:120459659-120459681 AACTAGCTGCTGAGCTACACTGG - Intronic
1076238406 10:128883581-128883603 AGCTGCCTGCCGCCCAGCACGGG + Intergenic
1076280359 10:129241721-129241743 CACTGCCTGCTGTCCTGCACTGG - Intergenic
1078796166 11:14593750-14593772 AACTTTCTGCTGCCTTACCCAGG - Intronic
1079833310 11:25299621-25299643 AACTGACTGCTCCCCACCACGGG + Intergenic
1080126562 11:28741433-28741455 CACTTCCTGCTGCTCTTCACAGG + Intergenic
1081569201 11:44279135-44279157 AGCTCCCTGCTACCCTAGACTGG - Intronic
1085558093 11:77443843-77443865 AGCTGCTTGGTGCCCTAGACAGG - Intronic
1088678925 11:112222446-112222468 AACTGCCTGCAGCCCTAGGTGGG + Intronic
1089020686 11:115211348-115211370 AGGTGCCTGCTGCCCAGCACAGG + Intronic
1096080188 12:48827901-48827923 AGCCTCCTGCTGCCCTACCCTGG + Exonic
1099237951 12:80104449-80104471 AAGTGCTTGCTACCATACACAGG - Intergenic
1100385436 12:94101453-94101475 AGGTGCCTGCAGCCCTACACTGG - Intergenic
1101321571 12:103677543-103677565 AACTGCCTGCTGCCCAGTGCAGG + Exonic
1102526027 12:113512800-113512822 AACTCCCTGCTGCCTTCCCCTGG - Intergenic
1103536127 12:121634904-121634926 AAGGGCCTGCTGCCCTGCTCCGG - Intronic
1104888551 12:132126928-132126950 AAATGCCTGCTGCCTTAAAAAGG - Intronic
1107765456 13:43729830-43729852 AACGGCCTTCTCCCCTGCACTGG + Intronic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1111152754 13:84279241-84279263 AACTGCCTGTTACCCTAGACAGG - Intergenic
1111845665 13:93505799-93505821 AACTGCTTGCTGCTCTGCACAGG + Intronic
1111880863 13:93955189-93955211 AACTTCCTTCTGCACTTCACTGG - Intronic
1115344384 14:32326912-32326934 AACTACCTATTGACCTACACTGG - Intergenic
1121000433 14:90448233-90448255 AACTGCCTCCTGCCCACCATAGG - Intergenic
1121446359 14:93981529-93981551 AACTGCGGGCAGCCCTTCACCGG - Intergenic
1122129676 14:99597794-99597816 AGCTGCCTCCGACCCTACACTGG + Intronic
1122161824 14:99790729-99790751 ACCTGCCTGCTGCCTTAGAGAGG + Intronic
1122283013 14:100635373-100635395 TAGAGCCTGCTGCCCTACAGAGG - Intergenic
1122809743 14:104282020-104282042 TGCTGTCTGCTGACCTACACTGG + Intergenic
1124059042 15:26271003-26271025 AGCTGCATGCTCCCCTGCACTGG - Intergenic
1125676512 15:41505026-41505048 AACTGCCTGCTGAGCTGCGCTGG - Exonic
1125751756 15:42033842-42033864 TGCTGCCAGCTCCCCTACACAGG - Intronic
1128901539 15:71427225-71427247 AACTGCTCACTGCCATACACTGG + Intronic
1129472500 15:75763372-75763394 ACCAGCCTCCTGCCCTCCACAGG + Intergenic
1131981954 15:98003109-98003131 AGCTGGCTGCTGCCCTTCAGAGG - Intergenic
1132145153 15:99425186-99425208 AACCGCCTGCTGCCTTCCATGGG + Intergenic
1132840978 16:1978450-1978472 GAGGCCCTGCTGCCCTACACTGG + Exonic
1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG + Intronic
1134569768 16:15281198-15281220 CGCTGCCTGCTGCCCTTCCCCGG - Intergenic
1134732613 16:16474850-16474872 CGCTGCCTGCTGCCCTTCCCCGG + Intergenic
1134934828 16:18237117-18237139 CGCTGCCTGCTGCCCTTCCCCGG - Intergenic
1135198751 16:20418462-20418484 AACTCCCTACTGCCTTGCACTGG - Intronic
1149579092 17:57735906-57735928 CACTGCCTGGAGCCCTCCACAGG - Intergenic
1151356727 17:73563054-73563076 CACTGCCTGCCGCCCCACCCTGG + Intronic
1151597485 17:75087497-75087519 GTCTGCCTGCTCCCCTACAAGGG + Intergenic
1151604977 17:75130365-75130387 ATCTGCCTGCTCCACTCCACGGG + Exonic
1152511099 17:80789493-80789515 ACCTTCCTGCTGTCCTCCACGGG + Intronic
1155172067 18:23274466-23274488 TACTGCCTGGTGCCCCACAGTGG + Intronic
1157597999 18:48875462-48875484 AACTGCTTGCTGTGCTACTCTGG - Intergenic
1160702540 19:514890-514912 CACTCCCTGGTGCCCTCCACGGG + Intronic
1161650243 19:5479948-5479970 ATCTCCCTGCTGCCCTTCCCTGG - Intergenic
1163418536 19:17201524-17201546 CCCTTCCTGCTGCCCCACACAGG - Intronic
1165450527 19:35879511-35879533 GACTCCCTGCTGCCCTAGGCTGG - Exonic
1165805012 19:38575152-38575174 AACTGCCTGCTTCCTCATACTGG - Intronic
1166394278 19:42427296-42427318 AACTGCCAGCTGCCTTAAAAAGG - Exonic
1166843273 19:45711724-45711746 AACTGGGTGCTGCCCTGCAATGG - Exonic
1167253656 19:48414852-48414874 CACTGCCCGCAGCCCTCCACCGG + Exonic
1168614466 19:57826693-57826715 ACCTGCGTGGTGCACTACACCGG - Intronic
929160418 2:38826635-38826657 CACAGCCTGCTGCTCTTCACTGG + Exonic
929299663 2:40288559-40288581 AACTGGCTGCAGCACAACACAGG - Intronic
929579269 2:43071356-43071378 AGCTGCCTCCTGCCCTCCAAGGG - Intergenic
929805146 2:45138515-45138537 ACCTGCCTGCAACTCTACACTGG + Intergenic
931833888 2:66079367-66079389 AAATGCTGGGTGCCCTACACAGG + Intergenic
932513988 2:72326019-72326041 CACTCTCTGCTGCCCTCCACCGG + Intronic
932555951 2:72825422-72825444 AACTACGTCCTGCCCTAGACAGG - Intronic
932716039 2:74101269-74101291 AGCTGCCTGCTGCCCCTCACCGG - Exonic
937205263 2:120232351-120232373 AGCTGCCTGCTGCCCTGCTCTGG + Intergenic
939994482 2:148907312-148907334 AACTGCAGGCTGTCCTTCACAGG - Intronic
941934915 2:170974714-170974736 AACTGCCGGCAGCTCCACACTGG - Intergenic
944508872 2:200444800-200444822 AACCTCCTGCTGCCCCATACAGG + Intronic
947387300 2:229604294-229604316 AACTCCCTGCTACCCCACATTGG - Intronic
947688926 2:232116704-232116726 AACTGACAGCTGCCCTACTCTGG + Intronic
948994568 2:241571927-241571949 ACCTGCCTGCTGCCCCCCAGGGG - Intronic
1168904560 20:1392833-1392855 ACCTGCGTGGTGCACTACACCGG - Exonic
1174847647 20:53958842-53958864 CATTGCCTGCTGTCCAACACTGG - Intronic
1175999191 20:62824535-62824557 AGCTGCCTCCTGCCCAGCACAGG - Intronic
1176246407 20:64099327-64099349 AGCTGCCTGCTGCACTTCCCGGG - Exonic
1178977263 21:37230818-37230840 ACCTGCCTACTGCCCTTCGCAGG - Intronic
1179955951 21:44738723-44738745 AGCTGCCTGGTGTCCTCCACAGG + Intergenic
1179982637 21:44904249-44904271 ACCTGCCTGCTGCCACACCCTGG + Intronic
1179984733 21:44914053-44914075 CCCTCCCTGCTGCCCCACACTGG + Intronic
1180613827 22:17114629-17114651 ATTTGCCTGCTTCCCTGCACGGG + Exonic
1180986414 22:19906754-19906776 GACTGCCTGCTGCCTTCCATTGG - Intronic
950093204 3:10312008-10312030 ATCTCCCTGCTGACTTACACCGG - Exonic
953469663 3:43155885-43155907 TACTGCCTGCTGCCCTCGCCTGG + Intergenic
956790115 3:72673667-72673689 AGCGGCCTGCTCCCCTTCACCGG - Intergenic
957636312 3:82790576-82790598 GAGTGCCTGCAGGCCTACACAGG - Intergenic
961743819 3:129050710-129050732 ACCTGCCTGATGCCCTGCCCTGG + Intergenic
962442111 3:135429811-135429833 AACTGCCTTCTGACCTCCACTGG + Intergenic
963778499 3:149464029-149464051 ACCTGCGTGATGCACTACACCGG - Intergenic
968940192 4:3633665-3633687 GGCTGCCTGCTGCTCTGCACCGG + Intergenic
974145614 4:57943777-57943799 AGCAGCCTGCTGCGCTCCACAGG + Intergenic
974895742 4:67936172-67936194 AACTGCTTGCTGCCCATCAGTGG - Intronic
978184179 4:105837413-105837435 AACCGCCTCCTGACCTATACTGG + Intronic
986192675 5:5511528-5511550 AACTGCCCCCTTCGCTACACAGG + Intergenic
989732398 5:44664437-44664459 AAGTGCCTGCTCCCCTTCCCTGG + Intergenic
993097810 5:83500693-83500715 GACTGCCTGCTGCTCTACTGGGG - Intronic
997197056 5:131987387-131987409 CACTGGCAGCTGACCTACACTGG - Intronic
999114456 5:149150149-149150171 TTCTGCCTGCTTCCCTACTCTGG - Intronic
999251574 5:150185490-150185512 AAGTGCCTGCTGCACTTCAGGGG - Intergenic
1000346213 5:160316189-160316211 TACTTCCTGCTGCCCGGCACAGG - Intronic
1007258670 6:40546484-40546506 AACTACCTCCTGGCCAACACTGG + Intronic
1007736775 6:43986956-43986978 CACTGACCGCTGCCCTAAACTGG - Intergenic
1009396999 6:63211620-63211642 ACCTGCGTGATGCACTACACCGG + Exonic
1015861619 6:137687082-137687104 GTCTGCCTGCAGCCTTACACTGG + Intergenic
1016827287 6:148400243-148400265 AACTGCCTCAGGCCCCACACAGG - Intronic
1023636189 7:42213233-42213255 AACTGCCAGCTACTCTACATTGG + Intronic
1024352555 7:48381747-48381769 AACTGCCTGCTGGCTTATGCAGG - Intronic
1026593723 7:71716891-71716913 AACTGCCTAGTTCCCTACACAGG - Intergenic
1027687472 7:81295225-81295247 AACTGCCTGCTCCCACACCCTGG - Intergenic
1028447799 7:90944781-90944803 AGCTGCCACCTGCCCCACACAGG - Intronic
1028826125 7:95275497-95275519 AACTGCCTGCTGCATAACCCTGG - Intronic
1033323206 7:140358688-140358710 AACGGCCTGCTGCAGTCCACTGG - Exonic
1034721143 7:153293936-153293958 AATTGCCTGGTGCCCTAAAGTGG + Intergenic
1034896351 7:154878709-154878731 AGCTGCCCGCTGCCTTCCACAGG - Intronic
1035773430 8:2168693-2168715 AGCTGCCTGCAGCCATGCACTGG - Intergenic
1039058434 8:33554830-33554852 AGCTGACCTCTGCCCTACACAGG - Intronic
1041716881 8:60940621-60940643 AACTGCCAGCTGCCCTAGCAGGG - Intergenic
1042040923 8:64587452-64587474 ACATGCCTGCTGCCATACAGGGG - Intergenic
1043515024 8:80988129-80988151 TCCTGCCTGGTGACCTACACAGG + Intronic
1047683299 8:127277145-127277167 AACTCCCAGCTGCTCCACACTGG + Intergenic
1048327051 8:133447995-133448017 AGCTGGCTGCTTCCCTACACTGG - Intergenic
1049007458 8:139864522-139864544 ATCTGCCTGGTGCCATCCACAGG - Intronic
1049322532 8:142004464-142004486 CCCTGCCTGCTGCCCCACAGAGG - Intergenic
1049472706 8:142783474-142783496 AAATGCCTGCAGCCCTGCAGTGG + Intergenic
1050705709 9:8394509-8394531 AACTACCAGCAGCCCTAGACAGG - Intronic
1054450564 9:65401632-65401654 GGCTGCCTGCTGCTCTGCACCGG - Intergenic
1062427597 9:136513020-136513042 AACTGCCTGCTGCCCTACACAGG - Exonic
1199659320 X:150032351-150032373 AACTGGCTGCTGGCCTAAATAGG + Intergenic