ID: 1062427953

View in Genome Browser
Species Human (GRCh38)
Location 9:136514696-136514718
Sequence ATGCTCCCTAAGGGCAGGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 255}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062427947_1062427953 6 Left 1062427947 9:136514667-136514689 CCGCACACTCATCGATGTTGATG 0: 1
1: 0
2: 0
3: 1
4: 73
Right 1062427953 9:136514696-136514718 ATGCTCCCTAAGGGCAGGGCGGG 0: 1
1: 0
2: 2
3: 48
4: 255
1062427943_1062427953 27 Left 1062427943 9:136514646-136514668 CCCCGTTGTGGCAGGGGTTGCCC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1062427953 9:136514696-136514718 ATGCTCCCTAAGGGCAGGGCGGG 0: 1
1: 0
2: 2
3: 48
4: 255
1062427945_1062427953 25 Left 1062427945 9:136514648-136514670 CCGTTGTGGCAGGGGTTGCCCGC 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1062427953 9:136514696-136514718 ATGCTCCCTAAGGGCAGGGCGGG 0: 1
1: 0
2: 2
3: 48
4: 255
1062427946_1062427953 7 Left 1062427946 9:136514666-136514688 CCCGCACACTCATCGATGTTGAT 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1062427953 9:136514696-136514718 ATGCTCCCTAAGGGCAGGGCGGG 0: 1
1: 0
2: 2
3: 48
4: 255
1062427944_1062427953 26 Left 1062427944 9:136514647-136514669 CCCGTTGTGGCAGGGGTTGCCCG 0: 1
1: 0
2: 1
3: 6
4: 157
Right 1062427953 9:136514696-136514718 ATGCTCCCTAAGGGCAGGGCGGG 0: 1
1: 0
2: 2
3: 48
4: 255
1062427942_1062427953 28 Left 1062427942 9:136514645-136514667 CCCCCGTTGTGGCAGGGGTTGCC 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1062427953 9:136514696-136514718 ATGCTCCCTAAGGGCAGGGCGGG 0: 1
1: 0
2: 2
3: 48
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062427953 Original CRISPR ATGCTCCCTAAGGGCAGGGC GGG Exonic
900637033 1:3671105-3671127 AGCCTCCCTCAGGGCTGGGCTGG + Intronic
900778728 1:4603361-4603383 ACGCTCCTTGAAGGCAGGGCTGG - Intergenic
900782347 1:4626312-4626334 TTCCTCCCAGAGGGCAGGGCAGG - Intergenic
900985196 1:6069117-6069139 AGGCTCCCTAAGGACAGGCTGGG - Intronic
903008506 1:20314306-20314328 ATGTTCCCTAAGTGCCAGGCTGG - Exonic
903258536 1:22118646-22118668 ATGGTTCCTAAGGGCAGAACAGG - Exonic
904074746 1:27831378-27831400 GAGCTCCCTGAGGGCAGGGATGG - Intronic
904460728 1:30678232-30678254 ATGCCCCATGAGGCCAGGGCAGG + Intergenic
905183295 1:36179322-36179344 ATTCCCCCGAAGGGCAGTGCTGG + Intronic
905352316 1:37356314-37356336 CTGGTCCTTGAGGGCAGGGCGGG - Intergenic
906004087 1:42454332-42454354 ATGCCCCACAAGGGCAGGGATGG - Intronic
907251836 1:53144651-53144673 AAGCTTCCTGAAGGCAGGGCAGG - Intergenic
907265158 1:53254822-53254844 ATGATCCCTAGGAACAGGGCTGG - Intronic
907390470 1:54154869-54154891 ATACTCCCAAAGGACAGGGGAGG + Intronic
907751985 1:57271567-57271589 ATGTCCCCTGAGGGCAGGGATGG - Intronic
909689135 1:78386809-78386831 AAGCTCCATAAGGGCAAGGACGG - Intronic
913111330 1:115659930-115659952 ACGCTACCAAAGGGCAGGACAGG - Intronic
913193589 1:116433889-116433911 AAGCACCCCAAGGGCAGGGCTGG - Intergenic
915285072 1:154847206-154847228 AGGCTCCCCGAGGGCAGGGGGGG - Intronic
915955923 1:160219794-160219816 AGCTTCCCTAAGGGAAGGGCAGG + Intronic
915958075 1:160239937-160239959 CCGCTCCCGAAGGGCAGGGAGGG + Exonic
916712477 1:167424297-167424319 ATCTTCCCTAAGGTCAGGTCGGG + Exonic
917539036 1:175895756-175895778 AAGCTCCCTGAGGGCAGGACTGG - Intergenic
917932136 1:179829951-179829973 AAGCTCCTTGAGGGCAGGGGTGG - Intergenic
919944236 1:202308094-202308116 ATGGTCTCTGAGGCCAGGGCTGG - Intronic
920399721 1:205669389-205669411 TAGCTCCCTAAGGGAAGGGAGGG + Intronic
921265081 1:213415535-213415557 AAGCTGCCCAAGGGCAGGGATGG - Intergenic
921286790 1:213616333-213616355 AGGCCATCTAAGGGCAGGGCGGG + Intergenic
922354191 1:224760562-224760584 ATGATACCAAAGGGCTGGGCAGG + Intergenic
922961609 1:229651632-229651654 AAGCTCCTTAAGGGCAGGAATGG - Intronic
924268992 1:242312775-242312797 ATGCTGCCTTGGGGCAGGGTGGG + Intronic
1064096919 10:12430627-12430649 ACGCTTCCTTAGGGCAGAGCTGG + Intronic
1065127525 10:22587923-22587945 AGGCTCACTGAGGGCAGGTCTGG - Intronic
1065683887 10:28264553-28264575 AAGCTCCCTGAGGCCAGGGCTGG - Intronic
1066238207 10:33507525-33507547 CTGCTCCCTGAGGCCATGGCGGG - Intergenic
1067038129 10:42933932-42933954 ATCCTCCCTGAGCGCAGCGCAGG + Intergenic
1067242674 10:44509348-44509370 ATGATCCCTAAGGGCAGCTGAGG - Intergenic
1069755862 10:70774177-70774199 AGGCTGCAGAAGGGCAGGGCGGG + Intronic
1069869444 10:71524287-71524309 AAGCTCCCTGAGGGCAGGGACGG - Intronic
1069908211 10:71744568-71744590 ATGCTCCCCAAGGGGTGGGATGG - Intronic
1069971413 10:72173345-72173367 AGGCTCCCAAAGGGTAAGGCAGG - Intronic
1070675048 10:78406585-78406607 CTGTTCCATAAGGGCAGGGGCGG - Intergenic
1070761042 10:79024604-79024626 AGGCTCCCTGAAGGCAGGCCTGG + Intergenic
1073442194 10:103558831-103558853 ATGCTCCCTCAGGGCAAGGAAGG + Intronic
1073510707 10:104040829-104040851 AAGCTCCCCAAGGGCAGAGCTGG + Intronic
1074249475 10:111730278-111730300 ATGCTCCTCAGAGGCAGGGCTGG + Intergenic
1075798319 10:125136287-125136309 ATGCACCCTGAGGTCAGGGCTGG - Intronic
1076676813 10:132151394-132151416 CTGCTCCCCAGGGGCTGGGCAGG - Intronic
1076992701 11:284063-284085 ATGGTGACAAAGGGCAGGGCAGG + Intronic
1077517033 11:3008189-3008211 GTGCTGCCCAAAGGCAGGGCAGG - Intronic
1078084118 11:8223640-8223662 AAGCTCCCCAAGGGCAGGGACGG + Intergenic
1079134520 11:17768807-17768829 AGACTCCCTAAGGGCAGGGCAGG - Intronic
1079320790 11:19449714-19449736 GTGCCCCTTGAGGGCAGGGCTGG + Intronic
1081614312 11:44581582-44581604 GTGCTCCCTGAGGGCAGGGATGG + Intronic
1081617510 11:44599557-44599579 GAGCTCCCTGAGGGCAGGGCTGG - Intronic
1083506518 11:63162937-63162959 ATGCTCCAGAAAAGCAGGGCAGG - Intronic
1083886866 11:65577258-65577280 AGGCTCCCCAGGGGAAGGGCTGG + Intronic
1083898127 11:65630459-65630481 ATGCTGCCTTTGGGCAGCGCTGG + Exonic
1083993225 11:66258992-66259014 ATGGTCTCTTAGGGCAGGGCTGG - Intronic
1084384590 11:68835231-68835253 ATGCTGGCTAGAGGCAGGGCAGG - Intronic
1084434754 11:69132228-69132250 AAGCTCCCTGAGGGTAGGGGCGG + Intergenic
1084757317 11:71248074-71248096 ATGGTCCCTAAACCCAGGGCAGG + Intronic
1084777468 11:71387045-71387067 ATGCTCCGTGTGGGCGGGGCAGG - Intergenic
1085302614 11:75467349-75467371 GAGCTCCCTCAGGGCAGGGATGG + Intronic
1087932973 11:103999673-103999695 ATGCTCCCTAAGCCCATGGCAGG + Intronic
1088051330 11:105518803-105518825 AAGCTCCATGAGGGCAGGGATGG - Intergenic
1089288372 11:117422157-117422179 AGGCTCCCCAAGGGCAGAGAAGG - Intergenic
1089680471 11:120116462-120116484 ATCCTCGCTTAGAGCAGGGCAGG - Intronic
1090550434 11:127813776-127813798 CTGCTCCCATGGGGCAGGGCAGG - Intergenic
1092915536 12:13185984-13186006 TTGCTCCCTAAGGGCTGAGCTGG - Intergenic
1096407898 12:51357228-51357250 AAGCTTCCTGAGGGCAGGGATGG + Intronic
1096567993 12:52497048-52497070 GTGCTCCCTAGGGACAGGCCTGG - Intergenic
1097030702 12:56087431-56087453 CTGCTCTCCAAGGGCAGGGAGGG + Intronic
1097790325 12:63808365-63808387 ATGCTCCATGAGGGCAAGGTAGG + Intronic
1098128429 12:67323277-67323299 AAGCTCCCAGAGGGAAGGGCAGG + Intergenic
1098517002 12:71388709-71388731 AAGCTCCTTGAGGGCAGAGCTGG + Intronic
1100206970 12:92360859-92360881 AAGCTCCCTGAAGGCAGGGATGG + Intergenic
1101072017 12:101085858-101085880 AAGCTCCATAAGGACAGGGAAGG - Intronic
1101157531 12:101941983-101942005 ATGTTCCCTGAGGGCAGAGCTGG - Intronic
1102961931 12:117098925-117098947 AGGCTTCCCAAGCGCAGGGCAGG - Intronic
1103052914 12:117796593-117796615 ATGCCTGGTAAGGGCAGGGCTGG - Intronic
1103210776 12:119164888-119164910 ATGCACGCAAAGGGCATGGCAGG - Intergenic
1103847086 12:123909071-123909093 AGCGTCCCTAAGGGCAGGGCCGG - Intronic
1104709873 12:130977899-130977921 ATGATCTCCAAGGGAAGGGCGGG + Intronic
1105069454 12:133225866-133225888 AGCCTCCCTCAGGGCAGGGCAGG + Intronic
1106776831 13:33016906-33016928 GTGCTCCCCAATGGCAGCGCGGG + Exonic
1108542659 13:51458161-51458183 AAGCTCACTAAGGGAAGAGCGGG - Intergenic
1108573571 13:51772249-51772271 CTGCTCACTGAGGGCAGGGGTGG + Intronic
1108582469 13:51838982-51839004 ATTCACCCTAAGGCCAGAGCTGG + Intergenic
1110554382 13:76842237-76842259 AAGCTCCATGAGGGCAGGGATGG - Intergenic
1112632016 13:101172231-101172253 AAGCTCCCTGAGGGCAGGCATGG - Intronic
1114675153 14:24435426-24435448 ATGCTTTCTTGGGGCAGGGCAGG + Intronic
1117102624 14:52366010-52366032 AGACTCCTCAAGGGCAGGGCTGG + Intergenic
1117825377 14:59696570-59696592 ATGGATCCCAAGGGCAGGGCTGG + Intronic
1119494786 14:75069437-75069459 CGGCTCCCCAAGGGCAGGGCTGG + Exonic
1121278695 14:92685255-92685277 CTGCTCCCCTAAGGCAGGGCTGG - Intronic
1122580434 14:102768405-102768427 AAGCTCCCTTGGGGTAGGGCAGG + Intergenic
1122994377 14:105254946-105254968 CTGCTCCTTGAGGGCAGGTCAGG + Intronic
1123033257 14:105461033-105461055 AGGCTCCCTCAGGGCAGAGTGGG - Intronic
1123068802 14:105631162-105631184 ATTCTCTCTGAGGGCAGGGCTGG - Intergenic
1123072956 14:105651120-105651142 ATTCTCTCTGAGGGCAGGGCTGG - Intergenic
1123092880 14:105749889-105749911 ATTCTCTCTGAGGGCAGGGCTGG - Intergenic
1123098359 14:105776989-105777011 GTTCTCTCTGAGGGCAGGGCTGG - Intergenic
1123107582 14:105849869-105849891 ATTGTCTCTGAGGGCAGGGCTGG + Intergenic
1202901996 14_GL000194v1_random:49566-49588 AGACTCCCCAAGTGCAGGGCAGG + Intergenic
1123993718 15:25703728-25703750 CTGCCCCCTAAGTTCAGGGCTGG - Intronic
1125477985 15:40060496-40060518 ATGCTCACCAGGGGCAGAGCAGG + Intergenic
1126740186 15:51769462-51769484 AAGCTCCTTGAGGGCAGGGCAGG - Intronic
1127501174 15:59555482-59555504 TTGCTCCATGAGGGCAGGGATGG - Intergenic
1127837312 15:62800280-62800302 ATGCAGCCTGAGGGCAGGCCAGG - Intronic
1128301797 15:66570608-66570630 TTGCTCCCTTAGCTCAGGGCTGG - Intergenic
1129228518 15:74183682-74183704 AAGCTTCTTAAGGGCAGGGAAGG + Intronic
1129455203 15:75673102-75673124 CAGCTCCCTGGGGGCAGGGCAGG + Intergenic
1129613916 15:77083151-77083173 ATGCTCCCTTTGGGCAAGGAGGG + Intronic
1132103912 15:99049300-99049322 ATGGGCTGTAAGGGCAGGGCTGG - Intergenic
1133257000 16:4523134-4523156 AGGCCCTCTAAGGGGAGGGCGGG + Intronic
1133802841 16:9098038-9098060 ATGCTCCCCCAGGGCTGGGGCGG + Intronic
1136354318 16:29733912-29733934 ATGTCACCCAAGGGCAGGGCCGG - Intergenic
1138298874 16:55910011-55910033 CTGCTCCCTGAGTGCTGGGCAGG + Intronic
1138552321 16:57754565-57754587 ACGGTCCCTGAGGGGAGGGCAGG - Intronic
1138598724 16:58042800-58042822 GAGCTCCCTGAGGACAGGGCTGG + Intronic
1139667028 16:68464417-68464439 ATGCTCCGTAAGGAAAGGGATGG + Intergenic
1139786256 16:69394713-69394735 ATGCTCCCTCAGGACTGGGAAGG - Intronic
1140433302 16:74923368-74923390 ATACTCACTAATGGTAGGGCCGG - Intronic
1141744497 16:85916405-85916427 TGGCTCTATAAGGGCAGGGCTGG + Intronic
1142006013 16:87689909-87689931 ATGCTCCTGGAGGGCCGGGCCGG + Exonic
1143272783 17:5688309-5688331 AAACTCCCTAAGGGCAGGGATGG - Intergenic
1144003195 17:11074548-11074570 ATGCTCCTGAAGCCCAGGGCTGG - Intergenic
1145975403 17:28981261-28981283 TTGGTGCCAAAGGGCAGGGCAGG + Intronic
1146950136 17:36899990-36900012 ATGCTCCCTGAGCCCAGAGCTGG + Intergenic
1146965337 17:37023764-37023786 ATGCTCCCTGAGGGCAGACTGGG - Intronic
1147453206 17:40519004-40519026 GAGCTCCCTGAGGGCAGGGCAGG + Intergenic
1147934128 17:44001782-44001804 GGGCTCCCTGAGGGCAGGACTGG - Intronic
1148494584 17:48045673-48045695 TGGCTCCCTAAGGGAAAGGCTGG - Intergenic
1148693659 17:49546720-49546742 AGGCCCCCTCAGTGCAGGGCAGG + Intergenic
1148775485 17:50093121-50093143 AAGCTCCGTGAGGGCAGGGCAGG - Intergenic
1149554451 17:57563369-57563391 ATGGTCCCCAAGTGTAGGGCTGG - Intronic
1151893758 17:76966636-76966658 GAGCTCCCTGAGGGCAGGGCTGG - Intergenic
1152239262 17:79153015-79153037 CTACTCCCTAAGTGCAGGGCAGG + Intronic
1152690730 17:81716611-81716633 CTCCTCCCTGAGGGCCGGGCGGG + Intronic
1152845579 17:82597595-82597617 AGGCTCTGTGAGGGCAGGGCTGG + Intronic
1155932289 18:31720377-31720399 AGGCTCCCTGAGGCCTGGGCTGG + Intergenic
1156520740 18:37720492-37720514 AAGCTCCTTAAGGGAAGGACTGG + Intergenic
1157186043 18:45540783-45540805 AAGCTCCCTGAGGGCTGGGGTGG + Intronic
1160658854 19:289025-289047 TTGATCCCTGAGGCCAGGGCTGG - Intronic
1160992515 19:1865500-1865522 AAGCCCCTTGAGGGCAGGGCTGG - Intergenic
1162989500 19:14293282-14293304 ATCCGCCCTAAGGGAAGGGGGGG - Intergenic
1163561736 19:18023379-18023401 AAGCCCCCTAAGGGCAGGACCGG + Intergenic
1164157684 19:22606385-22606407 CTGCTCCCTGAGCCCAGGGCTGG + Intergenic
1164311998 19:24054100-24054122 ATGCTCCCTGGGGGCAAGACAGG - Intronic
1165233115 19:34399791-34399813 TTGCTCACTTAGGGGAGGGCCGG + Intronic
1165641123 19:37387898-37387920 AAGCTCCATGAGGGCAGGGATGG - Intronic
1166368568 19:42289561-42289583 GGGCTTCCTGAGGGCAGGGCTGG - Intronic
1167117136 19:47494860-47494882 ACGCGCCCTGGGGGCAGGGCAGG + Intronic
1167205397 19:48098043-48098065 GGGCTCCCCAAGGGGAGGGCAGG + Intronic
925654082 2:6126084-6126106 ATGCTTCCTAATGACAGAGCTGG - Intergenic
925794726 2:7529507-7529529 ATTCTCCTTCAGGGCAGGGATGG - Intergenic
926278239 2:11422614-11422636 ATTCTGCCCAAGGGCAGGTCGGG - Intergenic
927381927 2:22489253-22489275 GTGCTCACTATGGGTAGGGCAGG + Intergenic
929133760 2:38603076-38603098 CTGCTCCCTATTGGCAGGGGCGG + Intronic
930357033 2:50334019-50334041 AAGCTCCCAAAGAGCAGGGCAGG - Intronic
931385746 2:61795955-61795977 AGGCTCCCTGAGGGCAGGACCGG + Intergenic
932430409 2:71670741-71670763 CTGCTCTCTGAGGGCAGGCCTGG - Intronic
932570705 2:72936951-72936973 AGGCTCCCTCAGGGAAGGGCTGG - Intergenic
932871876 2:75409123-75409145 ATGTTCCATAATGGCAGGGCTGG - Intergenic
933376023 2:81481311-81481333 ACGCTCCCTAAGGGCGAGCCAGG + Intergenic
937917017 2:127104275-127104297 CTGATCCCTGAGGGCACGGCAGG - Intronic
937945899 2:127336493-127336515 ATGCTCTCTAGGGGCAGCACAGG - Intronic
939409380 2:141804565-141804587 CTGTTCCCTAAGGACATGGCTGG - Intronic
939424984 2:142023833-142023855 ATGCTTCATAGAGGCAGGGCTGG - Intronic
942080704 2:172397071-172397093 ATGCTCCTTAAGGGCAGGGATGG + Intergenic
946127968 2:217581064-217581086 TTGCACCCTAAGGTCATGGCAGG + Intronic
946165987 2:217864069-217864091 ATGTTCCCTAAGAACAGGACAGG + Intronic
1169794875 20:9451157-9451179 ATGCTCTACAAGAGCAGGGCAGG - Intronic
1171385982 20:24769839-24769861 CTGCTCCCTGGGGGCAGGTCCGG - Intergenic
1171462153 20:25304206-25304228 GTGCTCCGTGAGGGCAGCGCTGG + Intronic
1172110205 20:32540156-32540178 AGGCTACCTCAGGGCAGGACAGG - Intronic
1172993783 20:39055041-39055063 AAGCTCTCGGAGGGCAGGGCTGG + Intergenic
1173834367 20:46115625-46115647 GAGCTCCCTGAGGGCAGGACTGG - Intergenic
1174173052 20:48628894-48628916 TGGCTCCCTCAGGGCAGGGCTGG - Intronic
1175971218 20:62687650-62687672 CTGCGCCCCAAGGGCAGGGCTGG + Intergenic
1176621365 21:9064333-9064355 AGACTCCCCAAGTGCAGGGCAGG + Intergenic
1179921449 21:44509755-44509777 ATGGTCGCTAGGGGCAGGGCTGG - Intronic
1180134481 21:45853329-45853351 ATGGCCCTTAAAGGCAGGGCTGG + Intronic
1180705635 22:17808293-17808315 CTGGTCACTTAGGGCAGGGCTGG - Intronic
1180998221 22:19975970-19975992 ATGAGTCCTAGGGGCAGGGCTGG - Intronic
1181934383 22:26428656-26428678 TGGCTCACTGAGGGCAGGGCGGG + Intergenic
1182098907 22:27644497-27644519 AAGCTCCATGAGGTCAGGGCTGG + Intergenic
1184139240 22:42568479-42568501 ATGGTCCCTAAGGACAGGGAAGG - Intronic
1184186503 22:42868680-42868702 CTGGCCCCTGAGGGCAGGGCAGG + Intronic
1184278138 22:43422041-43422063 ATGTCCCCTGAGGGCAGGGTCGG - Intronic
1184370189 22:44077053-44077075 ATGCTGCCCCAGGGCAGGCCCGG - Intronic
1184377672 22:44124749-44124771 TCACTCCCTCAGGGCAGGGCTGG + Intronic
1184454289 22:44600336-44600358 AAGCTCCTCAAGGCCAGGGCTGG - Intergenic
1185017487 22:48353238-48353260 CAGCTCCTCAAGGGCAGGGCTGG - Intergenic
1185095587 22:48804421-48804443 ATGCTCCCAAAGGGCACAGGAGG - Intronic
949892280 3:8742232-8742254 ATGCTCTCAGAGGGCTGGGCTGG - Intronic
950470975 3:13186203-13186225 CTGCTCCCTGAGGGCAGGGATGG + Intergenic
950611881 3:14132262-14132284 CTGAGCCCAAAGGGCAGGGCTGG + Intronic
953193406 3:40710694-40710716 AGGGTTCCCAAGGGCAGGGCAGG + Intergenic
954426201 3:50444382-50444404 AGGCTGCTTAAGGGCAGAGCAGG - Intronic
954577581 3:51685081-51685103 CTGCTCCCAGAGGCCAGGGCTGG + Intronic
954770151 3:52959823-52959845 AAACTCCCTAAGAGCAGGGATGG + Intronic
959492041 3:107001800-107001822 AAGCTCCTTAAGGGCAGAGATGG + Intergenic
961362286 3:126375728-126375750 GTCCTCCCTCAGGGCAGGGCAGG - Intergenic
963079417 3:141377082-141377104 ATGCTCCCATGGGGTAGGGCAGG - Intronic
964795733 3:160495084-160495106 AAGCTCCTTAAGGGCAAGGTCGG - Exonic
965118285 3:164519879-164519901 ATGCTCCCCAAGGGCTGTGGTGG - Intergenic
966093947 3:176175309-176175331 ATTCTCCCCAAGGGCAGGGAAGG - Intergenic
966816714 3:183895909-183895931 ATCCTCCCTAGGACCAGGGCTGG + Intergenic
966942512 3:184755923-184755945 GTGCTCCCTGAAGGCTGGGCTGG + Intergenic
969428343 4:7138769-7138791 AGGCTCCTTGAGGGCAGGGCTGG + Intergenic
971191680 4:24434591-24434613 ATGCTCTCTAAGGTCATGGTCGG + Intergenic
972410319 4:38786919-38786941 ATTCTCCCTAAGAGCACTGCGGG + Intergenic
976231533 4:82848862-82848884 CAGCTCCCCAAGGGCAGGCCTGG - Exonic
976473937 4:85461216-85461238 ATGCTCCCTTAGTGCAGTTCTGG + Intergenic
977300389 4:95260723-95260745 CTGCTCCCTAAAGCCAGGTCAGG - Intronic
979298252 4:119057080-119057102 ATAGTCACTAGGGGCAGGGCGGG - Intronic
981800678 4:148652104-148652126 CTGATCCCAAAGGGGAGGGCTGG + Intergenic
982273070 4:153611161-153611183 CTGCTCCACAGGGGCAGGGCGGG + Intronic
985552453 5:540547-540569 GTGCTGCCTCATGGCAGGGCTGG + Intergenic
988808440 5:34762029-34762051 AAGCTCCCTAAGGACAGGGATGG + Intronic
988817719 5:34851082-34851104 AAGCTCCCTCAGGGCGGGACTGG + Intronic
995752706 5:115470700-115470722 ATGGACCCTGAGGGCAGGTCTGG - Intergenic
997709257 5:135990296-135990318 AAGCTCCACAAGGGAAGGGCAGG - Intergenic
997813566 5:136995312-136995334 ATGCTCCCAAATAGCAGGGAAGG + Intronic
998214724 5:140228590-140228612 TAGCTCCACAAGGGCAGGGCAGG - Intronic
998318856 5:141210303-141210325 ATGCTGCCGATGTGCAGGGCGGG - Exonic
999419510 5:151428576-151428598 ATGCTCCCCAAGTGAAGGCCAGG - Intergenic
1000987219 5:167874258-167874280 AAGCTCTCTGAGGGCAGGGGTGG + Intronic
1001695250 5:173665054-173665076 AAGCTCCCTGAGGGCATGGTTGG + Intergenic
1002399929 5:178986097-178986119 AGGCTCCCAAGGGCCAGGGCAGG - Intronic
1002875281 6:1204478-1204500 ATTCTTGCTAAAGGCAGGGCAGG + Intergenic
1006379898 6:33691426-33691448 TTGCACACTAAGGGCAGGGAGGG - Intronic
1006436873 6:34030276-34030298 GGGTTCCCTGAGGGCAGGGCTGG + Intronic
1006510521 6:34518848-34518870 AAGCTCCATGAGGGAAGGGCTGG + Intronic
1007546782 6:42700383-42700405 CTGCTCCCTGAGGGCAGGGATGG + Intronic
1007704849 6:43784341-43784363 GGGCTCCCTGAGGGCAGGGCTGG + Intronic
1007708765 6:43807577-43807599 TGGCTCCCTAGGGGCAGGGCAGG + Intergenic
1007719214 6:43875507-43875529 AGACTCCCTAAGGGCAGGGTGGG - Intergenic
1013674787 6:112446454-112446476 AAGCTCCCAATGGGCAAGGCTGG + Intergenic
1014791635 6:125679031-125679053 ATGTTCCCAAATGGCAGAGCTGG + Intergenic
1016779684 6:147943971-147943993 ATGATCCCAAAGGGCAGCCCTGG - Intergenic
1017025944 6:150180712-150180734 AAGCTCCCTAAGAGCATGGCTGG + Intronic
1017539707 6:155387983-155388005 ATACTTACTAAGTGCAGGGCAGG + Intergenic
1019906935 7:4071937-4071959 GTGTTCACAAAGGGCAGGGCAGG - Intronic
1020081181 7:5286644-5286666 TTCCTCCCGAAGGTCAGGGCTGG + Intronic
1020382026 7:7557359-7557381 GTGGTCCCTCAGGGCAGGGGAGG - Intergenic
1022471819 7:30686284-30686306 TGCCTCCCCAAGGGCAGGGCTGG + Intronic
1022533849 7:31083754-31083776 AGAATCCCTAAGGGCAGGCCTGG + Intronic
1023098512 7:36688693-36688715 ATGTTCCTTAAGGGCAGGAATGG + Intronic
1024164325 7:46715182-46715204 ATGATTCCTGAGGGCAGAGCTGG + Intronic
1024882451 7:54103818-54103840 AAGCTCTCTGAGGACAGGGCTGG - Intergenic
1026611042 7:71860160-71860182 ATGCTCAATAAAGGCAGAGCAGG - Intronic
1026792991 7:73346810-73346832 ATGCTCCCTCAGGTAAGGTCTGG - Intronic
1026982258 7:74533674-74533696 TCCCTCCCTAAGGGAAGGGCTGG + Intronic
1027055417 7:75046347-75046369 GTGCTCCCTAATGGCTGGGGAGG - Intronic
1027262676 7:76476475-76476497 AAACTCCCTGAGGGCAGAGCTGG - Intronic
1032000316 7:128260835-128260857 ATGCTCCCCCAAGGCTGGGCTGG - Intergenic
1032521674 7:132550228-132550250 CTGCTCCCTAGAGGAAGGGCAGG - Intronic
1032840613 7:135710898-135710920 ATGCCCCCTGGGGGCAGGGAAGG + Intronic
1033570281 7:142620907-142620929 AGGCTCCGTAAGTGCAGGTCTGG + Intergenic
1034218214 7:149423595-149423617 ATTTTTCCCAAGGGCAGGGCCGG - Intergenic
1035351691 7:158251935-158251957 GGGCTCCCTAAGGGGAGGTCAGG + Intronic
1035683705 8:1507890-1507912 ATGCTCCCATTGGGCAGTGCAGG - Intronic
1036658260 8:10691467-10691489 ATGCTCCGTCAGGCCAGGCCAGG + Intronic
1036685827 8:10909496-10909518 TAGCTCCCTAAGGGCAGAGCAGG + Intronic
1036761051 8:11508794-11508816 ATGGCCCCAAAGGGCAGGACCGG - Intronic
1039412053 8:37363137-37363159 ATTCTCCCCAAGGCCAGAGCTGG + Intergenic
1040453506 8:47572895-47572917 AAGCTCCCTAAGCCCAGTGCAGG + Intronic
1042958828 8:74280812-74280834 ATGCTCCGTAATTGCAAGGCAGG - Intronic
1043574547 8:81642929-81642951 ATGCTCCATGAGGGCAGGGACGG + Intergenic
1043878955 8:85519539-85519561 ATACTCCCTGAGGCCAGGGATGG - Intergenic
1047916115 8:129585315-129585337 GAGCTCCCTGAGAGCAGGGCAGG - Intergenic
1048424798 8:134312877-134312899 GAGCTCCTTAAGGGCAGGACTGG + Intergenic
1049207066 8:141368525-141368547 AGGCTCCCCAAGGGAGGGGCTGG + Intergenic
1049211859 8:141390626-141390648 CTGGTCCTTAAGGGCAGGGGTGG - Intergenic
1049431324 8:142566657-142566679 AGGCTCCCAAAGGGCTGGGGAGG - Intergenic
1049457841 8:142702898-142702920 ATGCTGCTTCAGGGAAGGGCTGG - Intronic
1049786007 8:144451199-144451221 GTGCTCCCCTCGGGCAGGGCTGG - Intronic
1051142015 9:13988048-13988070 ATGCTCTCTGAGGGCAGCCCTGG + Intergenic
1051375684 9:16400053-16400075 ATTCTCCCTAACTGTAGGGCTGG + Intergenic
1051915310 9:22200411-22200433 GTGGTCCCTCAGGGCAGGGGTGG + Intergenic
1052972602 9:34386124-34386146 ATGCTGCCTGGGAGCAGGGCTGG + Intronic
1053462377 9:38280808-38280830 GTGCTCCCTAAGGCGAGGGTGGG + Intergenic
1056318880 9:85418160-85418182 ACTCTCCCTAAGAGCAGGGAAGG - Intergenic
1056361522 9:85862269-85862291 ATGCTCAGTAATGGCATGGCTGG + Intergenic
1059755432 9:117289163-117289185 CTGTTCCCTGAGGGGAGGGCAGG + Intronic
1060553803 9:124498276-124498298 AGGCGCTCTAAGGGCTGGGCTGG + Intronic
1060596539 9:124852339-124852361 AGGCTCCCTGGGGGCAGGGGTGG - Intergenic
1060727894 9:126017849-126017871 ATGCTCCCTTGGAGCAGGGAAGG - Intergenic
1061578672 9:131523525-131523547 GGGCTCGCTGAGGGCAGGGCCGG - Exonic
1061777558 9:132975829-132975851 CTGCTCACTAAGGGAAGTGCTGG + Intronic
1061952222 9:133942964-133942986 ATGCTCCCTGAAGGGAGGCCGGG - Intronic
1062427953 9:136514696-136514718 ATGCTCCCTAAGGGCAGGGCGGG + Exonic
1062582141 9:137233466-137233488 ACCCTCCATCAGGGCAGGGCGGG - Intronic
1203744563 Un_GL000218v1:34803-34825 AGACTCCCCAAGTGCAGGGCAGG + Intergenic
1203565538 Un_KI270744v1:84681-84703 AGACTCCCCAAGTGCAGGGCAGG - Intergenic
1187113863 X:16329556-16329578 ATAGTCCCTCAGGGAAGGGCAGG - Intergenic
1190878491 X:54476235-54476257 GAGCTCCCCAAGGGCAGGGATGG - Intronic
1196895233 X:120329656-120329678 ATGCTTCCTGAAGGCAGGCCAGG - Intergenic
1197764843 X:130053404-130053426 CTGATCCCTGAGGACAGGGCGGG + Intronic
1197775877 X:130118346-130118368 ATCCTCCCAAGGGGCAGGCCTGG + Intergenic
1197928913 X:131675891-131675913 ATGTTCTCTAAGGGCAGGACTGG + Intergenic
1200057651 X:153470129-153470151 AAGATCCCTAAGGCCAGGCCTGG + Intronic
1201157898 Y:11149786-11149808 AGACTCCCCAAGTGCAGGGCAGG + Intergenic