ID: 1062430088

View in Genome Browser
Species Human (GRCh38)
Location 9:136523064-136523086
Sequence GCTTCCATGGCCCCACCTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 242}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062430088_1062430099 18 Left 1062430088 9:136523064-136523086 CCGGCAGGTGGGGCCATGGAAGC 0: 1
1: 0
2: 1
3: 27
4: 242
Right 1062430099 9:136523105-136523127 TGTAGGAGGCCTCGAAGGGCAGG 0: 1
1: 0
2: 1
3: 8
4: 151
1062430088_1062430097 13 Left 1062430088 9:136523064-136523086 CCGGCAGGTGGGGCCATGGAAGC 0: 1
1: 0
2: 1
3: 27
4: 242
Right 1062430097 9:136523100-136523122 GCAGATGTAGGAGGCCTCGAAGG 0: 1
1: 0
2: 0
3: 6
4: 100
1062430088_1062430094 -9 Left 1062430088 9:136523064-136523086 CCGGCAGGTGGGGCCATGGAAGC 0: 1
1: 0
2: 1
3: 27
4: 242
Right 1062430094 9:136523078-136523100 CATGGAAGCTGGGTGGGCAGTGG 0: 1
1: 1
2: 6
3: 64
4: 615
1062430088_1062430100 24 Left 1062430088 9:136523064-136523086 CCGGCAGGTGGGGCCATGGAAGC 0: 1
1: 0
2: 1
3: 27
4: 242
Right 1062430100 9:136523111-136523133 AGGCCTCGAAGGGCAGGCACTGG 0: 1
1: 0
2: 2
3: 27
4: 214
1062430088_1062430096 4 Left 1062430088 9:136523064-136523086 CCGGCAGGTGGGGCCATGGAAGC 0: 1
1: 0
2: 1
3: 27
4: 242
Right 1062430096 9:136523091-136523113 TGGGCAGTGGCAGATGTAGGAGG 0: 1
1: 1
2: 5
3: 38
4: 358
1062430088_1062430095 1 Left 1062430088 9:136523064-136523086 CCGGCAGGTGGGGCCATGGAAGC 0: 1
1: 0
2: 1
3: 27
4: 242
Right 1062430095 9:136523088-136523110 GGGTGGGCAGTGGCAGATGTAGG 0: 2
1: 0
2: 3
3: 69
4: 558
1062430088_1062430098 14 Left 1062430088 9:136523064-136523086 CCGGCAGGTGGGGCCATGGAAGC 0: 1
1: 0
2: 1
3: 27
4: 242
Right 1062430098 9:136523101-136523123 CAGATGTAGGAGGCCTCGAAGGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062430088 Original CRISPR GCTTCCATGGCCCCACCTGC CGG (reversed) Exonic
900094601 1:935173-935195 GATTCCAAGCCCCCGCCTGCCGG + Intronic
900160377 1:1220466-1220488 GCTTCCCAGGCCCCTCCTCCAGG + Intronic
900367165 1:2315992-2316014 CCTGCTAGGGCCCCACCTGCCGG - Intergenic
900473093 1:2864068-2864090 CCTTCCCTGGCCCCATGTGCCGG + Intergenic
901468097 1:9436154-9436176 GCTTCCATGGCCCTGCCAGAGGG + Intergenic
901853565 1:12030468-12030490 GCTTCGGTCTCCCCACCTGCAGG - Intronic
901858175 1:12057488-12057510 ACCTCCATGGCCCAGCCTGCTGG - Intergenic
902041114 1:13493192-13493214 TCTTCCCTGGCCCCTGCTGCTGG - Intronic
902251585 1:15157017-15157039 GCTGCCATGGCCACCCCTCCTGG + Intronic
902407081 1:16190271-16190293 GCTTCAGTGGCACCACCTCCAGG + Intergenic
902617144 1:17630027-17630049 GCTTCCATGTCTCCATTTGCTGG + Intronic
902935456 1:19761679-19761701 GCTTCCTCGGTCCCACATGCAGG + Intronic
903125641 1:21245569-21245591 GCTCCTACTGCCCCACCTGCAGG + Intronic
903179264 1:21597249-21597271 GCTTCTGTGGCCTCATCTGCAGG + Exonic
903478637 1:23637592-23637614 GCTTCTATCGCGCCATCTGCTGG + Intronic
903512030 1:23883360-23883382 GCCTCCCTGGACGCACCTGCAGG - Intronic
904442160 1:30539050-30539072 TCCTGGATGGCCCCACCTGCTGG + Intergenic
904939668 1:34156920-34156942 ACCTCCATGGCCCCCTCTGCTGG - Intronic
905281586 1:36852796-36852818 GCTCCCAGGGACCCACTTGCTGG + Intronic
912761285 1:112369846-112369868 GACTCCACAGCCCCACCTGCTGG + Intergenic
912998523 1:114555953-114555975 GCATGCATGCCCCCACCTTCTGG + Intergenic
916723312 1:167501679-167501701 GCTGCCAGGGCTCCACCTGTGGG - Intronic
916854613 1:168737006-168737028 GCTTCCGGGACCCCACCTCCAGG - Intergenic
917260357 1:173160420-173160442 GTTTCCATGACCCCACCTTGGGG + Intergenic
919663905 1:200274143-200274165 GCTTCCATGCCCCCTCCTGATGG + Intergenic
921222842 1:212985752-212985774 GCTTCCATGTTCCCATCAGCAGG + Intronic
921418210 1:214915282-214915304 TCTCCCCTGGCCCCAGCTGCGGG - Intergenic
924685721 1:246287915-246287937 GCTTCCATGAGCACAGCTGCAGG + Intronic
1063422047 10:5920751-5920773 GCTTCCTTCGCCCCTCCAGCTGG - Intronic
1063460391 10:6211886-6211908 GCTTCCCTGCCCCCACCTCCAGG + Intronic
1065817637 10:29496549-29496571 GCTGCCATGGCTCCCCCTGCTGG + Intronic
1065955227 10:30687852-30687874 GCTGCCATGGCTCCCCCTGCTGG - Intergenic
1067257078 10:44651857-44651879 GCTTACATGGCTCCACATGGAGG + Intergenic
1068035798 10:51758531-51758553 GCTTCCAAGGAGCCAGCTGCAGG - Intronic
1068910572 10:62374577-62374599 GCTTCCCGGCCCCCACCAGCAGG + Intronic
1069484696 10:68814196-68814218 GCTTTGATGGCCCCAAGTGCAGG + Intergenic
1069823764 10:71242888-71242910 TGTTCCATGGCCCCACCTGCTGG - Intronic
1074889204 10:117721205-117721227 CCTTCCCTGGCCCTACCAGCTGG - Intergenic
1075207310 10:120458135-120458157 ACTTCCAGGGCCCAAGCTGCAGG + Intronic
1075514031 10:123095055-123095077 GCTTCCAAGTCCCCACCGGCTGG + Intergenic
1075533803 10:123253867-123253889 CCTTCCATGGCCCCACCGCTGGG - Intergenic
1076980172 11:199891-199913 GCACCCCTGCCCCCACCTGCAGG - Intronic
1077368857 11:2172326-2172348 GCTGCAAGGGCCACACCTGCAGG - Intergenic
1077416397 11:2426200-2426222 GCTTCCCTGACCTCAGCTGCTGG - Intergenic
1077490131 11:2857276-2857298 GCTACCATGCCCCCAGCTGATGG + Intergenic
1083325696 11:61871960-61871982 GCTTCCCTGGCCCTACCAGGAGG + Intergenic
1083783026 11:64927882-64927904 GCCTTCGTGGCCACACCTGCAGG + Exonic
1084185672 11:67469496-67469518 GCTTCCACGCCCCAACCTCCAGG + Intergenic
1084594162 11:70107259-70107281 GCTTGCCTCTCCCCACCTGCCGG - Intronic
1084967128 11:72750671-72750693 GCCTCCATTTCCCCATCTGCAGG - Intronic
1088101090 11:106156381-106156403 TTTTCCCTGGCCCCATCTGCTGG - Intergenic
1088610832 11:111575049-111575071 GCTTCCTTAGCCCCTCCTTCTGG + Intergenic
1089273349 11:117316114-117316136 GCTTCCCTGGTCCCCCCGGCGGG + Exonic
1090819288 11:130326535-130326557 GAGTCCATGGCTCCACATGCTGG - Intergenic
1092214448 12:6671203-6671225 TCTTCCTTGGCCCCACCTTATGG + Intronic
1092890535 12:12965405-12965427 GCTTCCCTGGCCACATCAGCAGG + Intergenic
1093733774 12:22595449-22595471 ACTTCCAGAGCCCCAGCTGCTGG - Intergenic
1094837672 12:34329751-34329773 GGATCCCTGGGCCCACCTGCAGG + Intergenic
1096659543 12:53115690-53115712 GCTGAGATGGCCCCACCAGCTGG - Intronic
1097492136 12:60283104-60283126 GCTGCCATGACGCCAGCTGCAGG - Intergenic
1100314790 12:93435067-93435089 GTTTCCCTGCCCCCACCTGGAGG + Intronic
1101761195 12:107660315-107660337 GCTCACATTGCCCCACCTCCCGG + Intergenic
1102542885 12:113635063-113635085 GCCTACAGGGCCCCACGTGCCGG - Intergenic
1102559981 12:113754935-113754957 GCTTCCCAGGCCCCATCTCCTGG - Intergenic
1104685330 12:130781050-130781072 GCTTCCCAGGCCGCACCTCCAGG + Intergenic
1106104165 13:26719284-26719306 ACTACCATTGCCCCTCCTGCTGG + Intergenic
1106606159 13:31231219-31231241 GCTTCCCTGGATCCACCTGAGGG - Intronic
1107508345 13:41058255-41058277 TCTCCCATGGCCCTCCCTGCAGG + Intronic
1110670750 13:78174330-78174352 GTTTCAATGGCCTCTCCTGCAGG - Intergenic
1113891218 13:113736577-113736599 GGTTCCATGGCCTCAGCAGCCGG + Exonic
1113961438 13:114128466-114128488 GCCTCCCTGGCCCCAGCTCCTGG - Intronic
1114649951 14:24278181-24278203 ACTTCACTGGCCCCACCTCCGGG - Intergenic
1117252802 14:53953112-53953134 GCTTCCAGCGCCCCGGCTGCCGG + Intronic
1119286096 14:73456856-73456878 GATTGCTTGGCCCCACCTGGGGG - Intronic
1119400359 14:74358539-74358561 GCTGTGATGGCCCCACCTGTGGG + Exonic
1121465970 14:94115774-94115796 GCCGCCATGGCCACAACTGCAGG - Exonic
1121522682 14:94597275-94597297 GCTTCAATGGCACCACCTCAGGG - Intronic
1122580103 14:102766288-102766310 GCTTTCATGGACCCAGCTCCAGG + Intergenic
1122710990 14:103658026-103658048 GCTTCCATGCCATCAGCTGCTGG + Intronic
1123931468 15:25173649-25173671 CCCTCCATGGACCCACCTGATGG - Intergenic
1125720249 15:41841900-41841922 GCTTCCACTGCCCAGCCTGCTGG + Exonic
1127320511 15:57840709-57840731 GCATCCAGAGTCCCACCTGCAGG - Intergenic
1128263581 15:66250239-66250261 GCTTGCATGACCCCAGCTCCTGG - Intronic
1128580543 15:68806934-68806956 TCTTCTATGTCCCCAGCTGCAGG + Intronic
1128980842 15:72184446-72184468 GCAGCCGTGCCCCCACCTGCTGG + Intronic
1129329818 15:74821243-74821265 GCATCCAAGGCTCCACCTGCGGG + Intronic
1129778931 15:78256483-78256505 GGTTCCATGGCCCCCTCTGCAGG + Intergenic
1132099720 15:99014895-99014917 GTTTCAATGGCTCGACCTGCCGG + Intergenic
1132683352 16:1152757-1152779 CCTTCCCTGCCCCCAACTGCGGG - Intergenic
1132849010 16:2015838-2015860 GCTTCCTTCTCCCCACCTCCAGG - Intronic
1133465189 16:6020821-6020843 GCCTCCCTGGCGCCAGCTGCGGG + Intronic
1133773627 16:8882181-8882203 GTTTCCACGGCCCCACATGGTGG - Intergenic
1134436656 16:14265088-14265110 GCTTCCATGCACCCACCTGACGG + Exonic
1135991784 16:27222973-27222995 GCTGCCCCGGCCCCTCCTGCAGG + Intergenic
1137500888 16:49010940-49010962 GCTTCCCTGACACCACCTCCCGG - Intergenic
1138234846 16:55373623-55373645 GCTTACATGCCCCCTCCTCCAGG + Intergenic
1138589204 16:57990511-57990533 GCCTCCATGGCCTCACCTCTAGG + Intergenic
1141195270 16:81855947-81855969 GTCTCCTTAGCCCCACCTGCAGG + Intronic
1141367598 16:83457685-83457707 GCTTGCATGGCCTGGCCTGCTGG - Intronic
1142015960 16:87747616-87747638 CCTGCCCTGGGCCCACCTGCTGG - Intronic
1142403148 16:89871564-89871586 GCTCCTCTGGCCACACCTGCTGG + Intergenic
1142481889 17:224153-224175 CCCACCAGGGCCCCACCTGCAGG + Intronic
1142561346 17:811277-811299 GCTCCCGTGGCCCAACCTTCAGG - Intronic
1143576107 17:7794269-7794291 GCTGCCATGGGCCCCCCTGGGGG + Exonic
1143731587 17:8885455-8885477 CCTCCCATGGCCCCACCTCCTGG + Intronic
1143731654 17:8885619-8885641 CCCCCCATGGCCCCACCTCCTGG + Intronic
1143731693 17:8885701-8885723 CCTCCCATGGCCCCACCTCCTGG + Intronic
1143731708 17:8885734-8885756 CCTCCCATGGCCCCACCTCCTGG + Intronic
1143731723 17:8885767-8885789 CCTCCCATGGCCCCGCCTCCTGG + Intronic
1143731738 17:8885800-8885822 CCTCCCATGGCCCCACCTCCTGG + Intronic
1144157232 17:12517618-12517640 GATTCCTGGGCCCCACCTTCTGG - Intergenic
1144976643 17:19142619-19142641 GGGTCAATGGCTCCACCTGCTGG - Intronic
1145006830 17:19343086-19343108 CCTTTCCTGGCCCCACCTCCAGG - Intronic
1145271951 17:21409541-21409563 GCTTCCCTGGCCTCCCCAGCGGG - Intronic
1145310159 17:21697006-21697028 GCTTCCCTGGCCTCCCCAGCGGG - Intronic
1145814686 17:27787164-27787186 GCTTCCATGTTCACACCTGTAGG + Intronic
1146910917 17:36647890-36647912 GCCTCCCTGGCCACACCTGCAGG - Intergenic
1148000542 17:44384847-44384869 GCCTCCATGGCCACCCCTGCCGG - Intronic
1148961723 17:51398934-51398956 CCTTCTATGGCCCCAGCAGCTGG + Intergenic
1150230182 17:63545469-63545491 GCTGCCCTGGCCCCAGCTGCAGG - Intronic
1150321361 17:64217135-64217157 GCTTCCAGGCCCCAAACTGCTGG + Intronic
1151395692 17:73821241-73821263 GCTTCCAATGCCCAGCCTGCAGG + Intergenic
1154087769 18:11323666-11323688 GCTTCCACGCCCCCACCCCCAGG + Intergenic
1156579033 18:38353934-38353956 GTTTCCATGGCCCCCCTTGGTGG - Intergenic
1158520200 18:58165966-58165988 GCTGGCTGGGCCCCACCTGCAGG + Intronic
1160148209 18:76380967-76380989 ACCTCCATGCCGCCACCTGCCGG + Intronic
1160989141 19:1853485-1853507 GGCTCCACGGCCCCACCTGCAGG + Exonic
1161467146 19:4437299-4437321 GCTTCCACAGCCCCACCTTTGGG - Intronic
1161582964 19:5090797-5090819 GCTTCCCTTGCCCCACTTGGAGG + Intronic
1161747176 19:6068133-6068155 CCTCCCATGGCACCAGCTGCTGG - Intronic
1162737077 19:12752562-12752584 TCTCCCTTGGCCACACCTGCCGG + Exonic
1165882275 19:39052674-39052696 GCTTGGCTGGCCCCAGCTGCTGG + Intergenic
1167118543 19:47502561-47502583 GCCTCCATGGTCCCACCACCAGG + Intronic
1168262273 19:55202401-55202423 GCCTCCCTGCCTCCACCTGCTGG - Intronic
925017998 2:546275-546297 CCTGCCATGGCCTCTCCTGCCGG - Intergenic
925626842 2:5849939-5849961 GCTACTCTGGACCCACCTGCTGG - Intergenic
925639232 2:5971532-5971554 GTTTCCCTGGCCTCACCTGCAGG + Intergenic
926760332 2:16273051-16273073 GCCTCCTTGGCCTCACCTGGGGG - Intergenic
927331272 2:21866689-21866711 GCTACCATTGGCCCACCTGTGGG + Intergenic
927709083 2:25314146-25314168 GCTTCGATGGCTCCACCTGTGGG + Exonic
928168805 2:28990317-28990339 CCTTCCAAGGCCCCACTTGAGGG + Intronic
928391985 2:30917299-30917321 GCATCCATGACCCCACCCACTGG - Intronic
931324998 2:61211786-61211808 GCTTAGATGGCCGCTCCTGCTGG - Exonic
933776139 2:85772350-85772372 GCTCCCATGGACTCACCAGCAGG - Intronic
934732751 2:96669726-96669748 GCTTCCCTGGCCTTCCCTGCTGG - Intergenic
935312007 2:101793513-101793535 GCTCCAATAGCCCCTCCTGCTGG - Intronic
937059880 2:118973459-118973481 ACTTCTATAGCCCCAGCTGCTGG - Intronic
937967615 2:127526084-127526106 GCCTCCTTGCCCCCACCCGCGGG + Intronic
940033828 2:149292376-149292398 GGTTTCATGTCCCCACCTTCTGG - Intergenic
942402879 2:175622071-175622093 GTGTCCATGGTCCCACCAGCAGG - Intergenic
942531064 2:176911046-176911068 GCTCACATGGTCCCACCTCCTGG + Intergenic
943626195 2:190202761-190202783 GCTTCCATGTTGCCACCTGGAGG - Exonic
944621748 2:201522885-201522907 GCTTCCATCCTCCCATCTGCTGG + Intronic
944716225 2:202377513-202377535 GCTACCATGGACCATCCTGCTGG + Exonic
946107828 2:217387642-217387664 CCTTCCATGCCCCCAACAGCTGG - Intronic
946307092 2:218862171-218862193 GCCTTCATGGCCACAGCTGCAGG + Intronic
948720480 2:239896524-239896546 CCTTCCGTGGCCCCACTGGCTGG - Intronic
948760050 2:240184708-240184730 TCTTCCATTTCCCCACCTGTGGG - Intergenic
948906828 2:240983670-240983692 GCTTCTGTGTCCTCACCTGCCGG + Intronic
1171355897 20:24545192-24545214 GCTTCCCGGGCTCCACCGGCTGG - Intronic
1171952718 20:31435678-31435700 ACTTGCATGGCCACACCTACTGG + Intergenic
1172093323 20:32448482-32448504 GCTGCCATGGTCCCTCCTGGGGG - Intronic
1172303040 20:33863148-33863170 GTTACAATGGCCCCACCTCCTGG - Intergenic
1172850076 20:37955476-37955498 GCTTCCAGGGCTACACCTGAAGG - Intergenic
1172867774 20:38113083-38113105 GCTTCCTTGGCCCCACCATGGGG + Intronic
1173852690 20:46228739-46228761 GCCTGCCTGGCCCCACCAGCAGG - Intronic
1174478642 20:50815312-50815334 GCTTCCGTGGCCTCCCATGCAGG + Intronic
1175823474 20:61924246-61924268 GCCTCCTTGGCCACACCTCCAGG - Intronic
1176053742 20:63134227-63134249 GTTTCCAGGGCCCCTCCTTCAGG - Intergenic
1176231536 20:64035707-64035729 GCTTCCCGGGCCCCCGCTGCTGG - Intronic
1178182222 21:30174711-30174733 GATTCCAGAGCCCCACCTCCAGG - Intergenic
1178696228 21:34794917-34794939 GCTTCCGTCACCCCACCCGCAGG - Intronic
1180064098 21:45404469-45404491 GCATCCTGAGCCCCACCTGCAGG - Intergenic
1180955527 22:19739648-19739670 GCTTCCAGGGGACCACCGGCTGG - Intergenic
1181004059 22:20001314-20001336 GCTTGCACAGACCCACCTGCAGG + Intronic
1181041708 22:20195445-20195467 GCTTCCCTGGGCCCCACTGCAGG + Intergenic
1181382755 22:22520175-22520197 GCTTCCTTGTCTCCACCTCCCGG + Exonic
1183225565 22:36547599-36547621 GCTTTCAAGGCCCTCCCTGCTGG - Intergenic
1183948007 22:41337790-41337812 GAGCCCATGCCCCCACCTGCTGG + Intronic
1184820422 22:46905671-46905693 GCTCCCTTGGCCCCAACTTCTGG - Intronic
1184831582 22:46992234-46992256 GCTTCCAAGCCCCCTCCTGGCGG + Intronic
1184945289 22:47798264-47798286 GCTTCCATGCCACCTCCTCCAGG - Intergenic
950319267 3:12035189-12035211 GATTCCATGTCCCCATCTTCGGG + Intronic
950573568 3:13817072-13817094 AGCCCCATGGCCCCACCTGCTGG - Exonic
950656816 3:14441664-14441686 GCTGGCTTGGCCCCAGCTGCTGG - Intronic
951992717 3:28693711-28693733 GATTCCAAGTCCCCTCCTGCAGG + Intergenic
952961118 3:38589695-38589717 GCTACCCGGGCCCCACCTGTAGG - Intronic
954946890 3:54433953-54433975 GCTTCCATTCCCCCACCTGGTGG + Intronic
957484949 3:80848492-80848514 GCTTCCATGTCCCCAGGTCCAGG - Intergenic
960393500 3:117108158-117108180 GATTCCTTGGCCCCATCTGCTGG - Intronic
969690519 4:8701629-8701651 GCTGCCCAGGCCACACCTGCAGG - Intergenic
974045230 4:56892883-56892905 TCTTCCATGGCTCCCCCTCCTGG + Intergenic
976789644 4:88863516-88863538 GGTTCCATGGCCCCAACTTCAGG - Intronic
979035293 4:115708303-115708325 GCTTCAATGGCACCACTTACTGG + Intergenic
981511885 4:145566554-145566576 GCTTCCTTTTCCCCACCAGCAGG + Intergenic
981752288 4:148103816-148103838 GACTCCACGGCCCCAGCTGCAGG + Intronic
984590002 4:181606591-181606613 GGATCCATGGCCTCACATGCAGG + Intergenic
986175460 5:5348371-5348393 GGCTCCTTGTCCCCACCTGCAGG - Intergenic
986532766 5:8756685-8756707 GCTCTGATGGCACCACCTGCTGG - Intergenic
988842378 5:35095530-35095552 ACTTTCATCTCCCCACCTGCAGG - Intronic
989444804 5:41514817-41514839 TCTTCCATTTCCCCACCTCCAGG - Intergenic
992974527 5:82100462-82100484 GCTTCCTGAGCTCCACCTGCTGG + Intronic
997376927 5:133403955-133403977 GCTCCCATGGCCTTCCCTGCAGG + Intronic
998250961 5:140552100-140552122 GCTCCCAGGTCCCCACCTGTGGG - Exonic
998530221 5:142877449-142877471 GCTTCCATGTCCCCAACATCAGG + Intronic
998627319 5:143860403-143860425 GCCTCCATGGGGACACCTGCTGG + Intergenic
998903412 5:146878631-146878653 GCTTCCCTACCCCCGCCTGCCGG - Intronic
1000312208 5:160056000-160056022 GCTTCCCTTGCCCCAGGTGCTGG + Intronic
1003282447 6:4705796-4705818 AGTTCCAAGGCCCCATCTGCAGG + Intergenic
1005736434 6:28751973-28751995 TCTTCCCTTTCCCCACCTGCTGG - Intergenic
1006813345 6:36835059-36835081 GCTTCCCTCTCCCCACCAGCTGG - Intronic
1007268917 6:40620821-40620843 GCTTTCAGGTCCCCACTTGCGGG + Intergenic
1007594935 6:43045571-43045593 ACATCCCTGGCCCCACCTGCTGG + Exonic
1011265785 6:85517250-85517272 GCTTCCATAGCTCCCCATGCTGG + Intronic
1011282279 6:85689017-85689039 GCTTCCTTGGCCCTACTGGCAGG - Intergenic
1017656081 6:156631101-156631123 GCAGCCTTGGCCCCACCTCCAGG - Intergenic
1017905842 6:158757113-158757135 CCTTCCAGGGCCCCACTTCCCGG - Intronic
1019394625 7:810842-810864 CCTGCCATGGCCACACCTGGAGG - Intergenic
1019513021 7:1427676-1427698 GCTTCCACGCCCGCCCCTGCAGG + Intergenic
1019593019 7:1845039-1845061 GCAGCCAAGGCCCCACCTGGCGG + Intronic
1019874420 7:3796538-3796560 CATTCCAGGACCCCACCTGCTGG + Intronic
1022475381 7:30706478-30706500 CCTTCCCTGGCCCCACTGGCGGG - Intronic
1024055705 7:45658823-45658845 GCTTCCAGGGCCCCTCCGGGGGG + Intronic
1024318243 7:48041222-48041244 GCTTGCACTGCCCCACCTGATGG + Intronic
1024511462 7:50207854-50207876 CCTTCCCTGGCCACACCCGCTGG - Intergenic
1025031679 7:55561875-55561897 CCTTCCATGACACCACCTGAGGG + Intronic
1029435929 7:100564069-100564091 GCTTCCCTGGTCCCCCCTGCTGG - Intronic
1029570343 7:101364105-101364127 GTGGCCATGGCGCCACCTGCCGG - Intronic
1029599275 7:101554180-101554202 GCTTTCAAGGCCCCCCCTGCCGG - Intronic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1030176419 7:106660160-106660182 GCCTCCAGGGCGCCTCCTGCCGG - Exonic
1035176401 7:157055133-157055155 CCTCCCACAGCCCCACCTGCAGG + Intergenic
1035745548 8:1959997-1960019 GCTTCCGGGCCCCCATCTGCTGG + Intergenic
1037860157 8:22399206-22399228 GCGCGCATGGCCCCAGCTGCAGG - Intronic
1038496458 8:28006878-28006900 TCTTACGTGTCCCCACCTGCAGG + Intergenic
1040744723 8:50627629-50627651 GTTCCCATGACCCCACCTTCAGG + Intronic
1040960542 8:53027439-53027461 GCTTCAATGACCCCACCAGCTGG + Intergenic
1042353224 8:67799279-67799301 GCTTCCACGTCCCAACTTGCTGG + Intergenic
1042733714 8:71964541-71964563 TCTTCATGGGCCCCACCTGCTGG + Intronic
1042942237 8:74118969-74118991 GCGCCCATGGCTCCACCTACTGG - Intergenic
1045187983 8:99857666-99857688 GCTTCCACGGCCTCACAGGCAGG - Intronic
1045252641 8:100494440-100494462 GCGGCCATGGCCCCGCCCGCCGG - Intergenic
1046950995 8:120019661-120019683 GCTTGCAGGGCCCCTCATGCCGG + Intronic
1047390976 8:124451122-124451144 GCTTCCAGAGCAGCACCTGCAGG + Exonic
1048133386 8:131721654-131721676 GCTTCCACTTCCCCATCTGCTGG + Intergenic
1048844832 8:138596378-138596400 GCTCACATGGCCCCTCCTCCAGG + Intronic
1049291906 8:141807818-141807840 GCTCCCATGGCACCCTCTGCAGG - Intergenic
1056297730 9:85209322-85209344 GCTTCCCTGGTCCCATTTGCTGG - Intergenic
1057262523 9:93593148-93593170 GCTGCCATGTCCCGTCCTGCTGG - Intronic
1060474200 9:123974672-123974694 ACTTTCTGGGCCCCACCTGCCGG - Intergenic
1061077254 9:128349154-128349176 GCCTCCCTGACCCCACCTCCAGG + Intronic
1061681288 9:132243611-132243633 GCTGCCACTGCTCCACCTGCAGG + Exonic
1062337643 9:136079424-136079446 GGTTCCTTGGCTGCACCTGCAGG - Intronic
1062430088 9:136523064-136523086 GCTTCCATGGCCCCACCTGCCGG - Exonic
1185997408 X:4967347-4967369 GCCTCCATGACCCTACCTCCTGG + Intergenic
1186556693 X:10567368-10567390 CCTTCCAGTGCCCCACCTGCCGG - Exonic
1186950352 X:14617682-14617704 GTTTGCATGGCCTCACCTGGTGG - Intronic
1187055503 X:15738273-15738295 GCTTCGATGGCCGGACGTGCAGG + Exonic
1187497491 X:19808138-19808160 TCTTCCCTCACCCCACCTGCAGG - Intronic
1187851394 X:23594808-23594830 GCTTCCTTGGCCTCATGTGCTGG + Intergenic
1190385408 X:49879171-49879193 GATTCCTTGGCTCCACCCGCAGG - Intergenic
1192191698 X:68995184-68995206 ACTTCCGTGATCCCACCTGCAGG + Intergenic
1196576089 X:117320750-117320772 ACTTGCTGGGCCCCACCTGCAGG - Intergenic
1199308749 X:146297977-146297999 ACTTCCATAGCCACACCAGCTGG + Intergenic
1200684243 Y:6245493-6245515 GCTTCCAGAGCCCCACCAGCAGG + Intergenic
1200690870 Y:6305802-6305824 GCTTGCAGAGCCCCACCAGCAGG - Intergenic
1200958318 Y:8972842-8972864 GCTACTATGCCCCCACATGCCGG - Intergenic
1201010837 Y:9547339-9547361 GCTTGCAGAGCCCCACCAGCAGG + Intergenic
1201044402 Y:9868914-9868936 GCTTGCAGAGCCCCACCAGCAGG + Intergenic
1201048390 Y:9908893-9908915 GCTTGCAGAGCCCCACCAGCAGG - Intergenic
1202115655 Y:21467403-21467425 GCTTGCAGAGCCCCACCAGCAGG + Intergenic