ID: 1062430532

View in Genome Browser
Species Human (GRCh38)
Location 9:136525139-136525161
Sequence GAAACCAAGGTGCCAGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062430526_1062430532 -6 Left 1062430526 9:136525122-136525144 CCCACATTACAGCCGGGGAAACC 0: 1
1: 0
2: 2
3: 12
4: 340
Right 1062430532 9:136525139-136525161 GAAACCAAGGTGCCAGGAGGAGG No data
1062430527_1062430532 -7 Left 1062430527 9:136525123-136525145 CCACATTACAGCCGGGGAAACCA 0: 1
1: 0
2: 0
3: 16
4: 259
Right 1062430532 9:136525139-136525161 GAAACCAAGGTGCCAGGAGGAGG No data
1062430522_1062430532 9 Left 1062430522 9:136525107-136525129 CCAGGAGCAGAAGCACCCACATT 0: 1
1: 0
2: 0
3: 27
4: 255
Right 1062430532 9:136525139-136525161 GAAACCAAGGTGCCAGGAGGAGG No data
1062430521_1062430532 22 Left 1062430521 9:136525094-136525116 CCAGGCACATCAGCCAGGAGCAG 0: 1
1: 0
2: 1
3: 29
4: 356
Right 1062430532 9:136525139-136525161 GAAACCAAGGTGCCAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062430532 Original CRISPR GAAACCAAGGTGCCAGGAGG AGG Intronic
No off target data available for this crispr