ID: 1062433249

View in Genome Browser
Species Human (GRCh38)
Location 9:136535246-136535268
Sequence AGGGGCCTTGTGAACCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 230}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062433249_1062433268 24 Left 1062433249 9:136535246-136535268 CCCCCAGGGTTCACAAGGCCCCT 0: 1
1: 0
2: 2
3: 15
4: 230
Right 1062433268 9:136535293-136535315 TTTGCATTAGGCAGGGCGTGCGG No data
1062433249_1062433266 17 Left 1062433249 9:136535246-136535268 CCCCCAGGGTTCACAAGGCCCCT 0: 1
1: 0
2: 2
3: 15
4: 230
Right 1062433266 9:136535286-136535308 CCACCGCTTTGCATTAGGCAGGG No data
1062433249_1062433264 16 Left 1062433249 9:136535246-136535268 CCCCCAGGGTTCACAAGGCCCCT 0: 1
1: 0
2: 2
3: 15
4: 230
Right 1062433264 9:136535285-136535307 GCCACCGCTTTGCATTAGGCAGG No data
1062433249_1062433270 30 Left 1062433249 9:136535246-136535268 CCCCCAGGGTTCACAAGGCCCCT 0: 1
1: 0
2: 2
3: 15
4: 230
Right 1062433270 9:136535299-136535321 TTAGGCAGGGCGTGCGGAGAGGG No data
1062433249_1062433269 29 Left 1062433249 9:136535246-136535268 CCCCCAGGGTTCACAAGGCCCCT 0: 1
1: 0
2: 2
3: 15
4: 230
Right 1062433269 9:136535298-136535320 ATTAGGCAGGGCGTGCGGAGAGG No data
1062433249_1062433263 12 Left 1062433249 9:136535246-136535268 CCCCCAGGGTTCACAAGGCCCCT 0: 1
1: 0
2: 2
3: 15
4: 230
Right 1062433263 9:136535281-136535303 CGAAGCCACCGCTTTGCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062433249 Original CRISPR AGGGGCCTTGTGAACCCTGG GGG (reversed) Intronic
900095230 1:937509-937531 AGAGGCCTTGCTAACCCTGAGGG + Intronic
900160011 1:1219049-1219071 TGGGGACGTGTGAATCCTGGAGG - Intronic
900755033 1:4428650-4428672 AGGGGCCTGGTGAAGACTGTGGG + Intergenic
900796111 1:4709293-4709315 TGGGGCCTGGTGAAGCCTGGTGG + Intronic
900932469 1:5745965-5745987 ATGGGCCTGCTGACCCCTGGTGG + Intergenic
902288782 1:15423334-15423356 ATGGGTCTTGGGAGCCCTGGAGG - Intronic
903501692 1:23803825-23803847 AGGGCCCTGGTGGACTCTGGCGG + Intronic
904403736 1:30273197-30273219 AGGAGCCCAGTGAACACTGGTGG + Intergenic
905307068 1:37027177-37027199 AGAGGCAGTGTGGACCCTGGAGG + Intronic
907395500 1:54186849-54186871 TGGGGCCTTGGGACCTCTGGGGG + Intronic
908697001 1:66854958-66854980 TAGGGCCTTGCTAACCCTGGAGG + Intronic
909931462 1:81503736-81503758 AGGTGGCTGGGGAACCCTGGAGG - Intronic
910127222 1:83856191-83856213 ATTTGCCTTGTGAACCCTTGTGG - Intergenic
915213789 1:154327454-154327476 AGGGGTCTTCCCAACCCTGGTGG - Intronic
916196495 1:162228553-162228575 AGGGGCCTGGTGAACCCCCTAGG + Intronic
922843703 1:228665855-228665877 TGGGGCCTTGCTGACCCTGGAGG - Intergenic
922873101 1:228918894-228918916 AGGGGTCTTGCTGACCCTGGAGG + Intergenic
924631979 1:245749745-245749767 AGGGGCCTGGTGAACCCCACAGG + Intronic
1062802567 10:390931-390953 AGGGTCTGTGTGAACGCTGGAGG - Intronic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064722055 10:18238955-18238977 AGAGGCGATGTGAACCCTGAAGG + Intronic
1065521167 10:26574278-26574300 CTGGGCCTTGTTGACCCTGGAGG - Intergenic
1065526588 10:26627931-26627953 CTGGGCCTTGTTGACCCTGGAGG - Intergenic
1065559840 10:26951827-26951849 TTGGGCCTTGTTGACCCTGGAGG + Intergenic
1065626248 10:27631857-27631879 AGGGGCCATGTGACTTCTGGGGG + Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1066561484 10:36674525-36674547 AGGAGCCATGTGAACCCGGGAGG + Intergenic
1067090977 10:43265816-43265838 AGGGGGCGGGAGAACCCTGGGGG + Intronic
1067800523 10:49355333-49355355 AGGGGCCTTGAGAAGCAGGGTGG - Intergenic
1070154551 10:73825376-73825398 AGTGGCCTTGGGGACTCTGGAGG - Intronic
1071706420 10:88004386-88004408 AGGAGCCTTGTCAACCTTGATGG + Intergenic
1075416186 10:122266071-122266093 TGGGGCCTTGCTCACCCTGGAGG - Intergenic
1075635430 10:124027239-124027261 AGGGGTCCTGGGACCCCTGGAGG + Intronic
1075718671 10:124572181-124572203 AGGGACCTTTTGAAACCTGAAGG - Intronic
1076568317 10:131413638-131413660 AGGACCCTAGAGAACCCTGGAGG + Intergenic
1076861697 10:133140966-133140988 AGGGGCCTCGGGAACCACGGTGG + Intergenic
1077071216 11:674430-674452 AGGGGCCTTGTGAGCCAAGGTGG + Intronic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1077661718 11:4074495-4074517 CTGGGCCTTGTGCAGCCTGGGGG - Exonic
1078011550 11:7576521-7576543 AGGGGCCTTGGAAAGGCTGGCGG - Intronic
1082646752 11:55735578-55735600 TTGGGCCTTGTGAACCCTGGAGG - Intergenic
1083429787 11:62608319-62608341 AGGTGCAGAGTGAACCCTGGAGG + Intronic
1083899327 11:65636167-65636189 ACAGCCCTTGTGAAGCCTGGGGG - Exonic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1085454871 11:76660122-76660144 GGGGGCCTTGGGAGGCCTGGAGG - Exonic
1085488116 11:76885847-76885869 TGGGGCCTTGCTTACCCTGGTGG - Intronic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1090036218 11:123251904-123251926 AGGCTCCCTGTGAACCCTGTAGG - Intergenic
1091302137 11:134514599-134514621 AGGGGCCTTGTGTAGACTGGTGG - Intergenic
1091491022 12:932682-932704 GGGAGTCTTGTGAACTCTGGAGG - Intronic
1091982437 12:4877300-4877322 TGGGGCCTTGCAGACCCTGGAGG + Intergenic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092480130 12:8852136-8852158 AGAGGCCTGGGGAAACCTGGGGG - Intronic
1094693075 12:32788673-32788695 AGGGGCTTTGTGAACCTAGATGG - Intergenic
1101741497 12:107503419-107503441 TGGGGCCTTGCTGACCCTGGAGG - Intronic
1106661921 13:31808698-31808720 AGGGGAGATGAGAACCCTGGTGG + Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1107609858 13:42102357-42102379 AGGGGCCAGGAGAAGCCTGGTGG + Intronic
1112285992 13:98104786-98104808 TGGGGCCTTGCTGACCCTGGAGG - Intergenic
1114500349 14:23163718-23163740 AGGGACCCAGTGAACCCTAGAGG + Intronic
1122203028 14:100133980-100134002 AGGAGCTTTGTGAGGCCTGGGGG - Intronic
1125469355 15:39987257-39987279 GGGGGCCTTGTGAGGCCCGGAGG + Intronic
1125550060 15:40538420-40538442 AGGTGCCCTGTGACCCCTTGAGG - Intronic
1127469990 15:59282290-59282312 AGGGGGCTTGGGAGCCCTGATGG - Intronic
1127642489 15:60929093-60929115 AGGGGCCTTGTAGACCCAGCAGG - Intronic
1128213590 15:65918671-65918693 GAGGGCCTTGTGAACTCAGGAGG - Intronic
1129295125 15:74596041-74596063 AGGTGGCTGGGGAACCCTGGAGG - Exonic
1130797782 15:87228984-87229006 CATGGCATTGTGAACCCTGGAGG - Intergenic
1131069894 15:89459639-89459661 AGTGGCCTTGTGAACACCTGTGG + Intergenic
1132063916 15:98714963-98714985 GAGGGGCTTGTGGACCCTGGAGG + Intronic
1132201295 15:99956365-99956387 TGGGGCCTTGCCAACCCTGAAGG - Intergenic
1132302644 15:100785648-100785670 AGGTGCCTTGTGCACCAGGGCGG + Intergenic
1132547871 16:541457-541479 AGGGGCCGTGTGGGGCCTGGTGG + Intronic
1132624713 16:886571-886593 AGGGGCCTGGGGAACGCCGGGGG - Intronic
1132624730 16:886605-886627 AGGGGCCTGGGGAACGCCGGGGG - Intronic
1132624747 16:886639-886661 AGGGGCCTGGGGAACGCCGGGGG - Intronic
1132624764 16:886673-886695 AGGGGCCTGGGGAACGCCGGGGG - Intronic
1132624781 16:886707-886729 AGGGGCCTGGGGAACGCCGGGGG - Intronic
1132624798 16:886741-886763 AGGGGCCTGGGGAACGCCGGGGG - Intronic
1132624815 16:886775-886797 AGGGGCCTGGGGAACGCCGGGGG - Intronic
1132624832 16:886809-886831 AGGGGCCTGGGGAACGCCGGGGG - Intronic
1132624849 16:886843-886865 AGGGGCCTGGGGAACGCCGGGGG - Intronic
1132640468 16:976014-976036 AGGGGCCTCATGAACTCTGAAGG + Intronic
1132845605 16:1999579-1999601 AGGGGCCTTGGGAGCCCAGGGGG + Exonic
1135958901 16:26979534-26979556 AGGGGCCATGTGAGCATTGGTGG - Intergenic
1140140611 16:72253260-72253282 AGAGGCCTTTTCAACCCTGCAGG - Intergenic
1140219903 16:73036245-73036267 ACTGGCCTTGTGATCCCTAGTGG - Intronic
1141450006 16:84092891-84092913 AGAGGCCTGGGGAAGCCTGGAGG + Intronic
1144064990 17:11616956-11616978 AGGGTCCTTGTGAAGGCTGAAGG - Intronic
1144406168 17:14954676-14954698 TGGGGCCTTGCTGACCCTGGAGG - Intergenic
1145063833 17:19748757-19748779 TGGGGCCCTGTGCACACTGGGGG - Intronic
1145888575 17:28399141-28399163 AGGGGCTTGGTGATCTCTGGAGG - Exonic
1146275883 17:31515305-31515327 AGGGGCCCTGGGAACCCTGGGGG + Intronic
1147212133 17:38877854-38877876 ATGGGCCATTTGAACCCAGGAGG - Intronic
1147364061 17:39948751-39948773 AGGGGCCCTGTGAACCCATAAGG + Intergenic
1148578304 17:48726558-48726580 AGGTTCTTTGGGAACCCTGGTGG + Exonic
1148581499 17:48747160-48747182 AGGAGCCTTGGCGACCCTGGAGG - Intergenic
1150293755 17:63997173-63997195 ATGTGCCATCTGAACCCTGGAGG - Intergenic
1151470094 17:74312589-74312611 ATGGGCCTTGAGACCCCTGGAGG + Intronic
1151935705 17:77259605-77259627 AGGGGCCTTCTGCAGCCAGGTGG + Intergenic
1152035057 17:77867327-77867349 TGGGGCCTTCCGGACCCTGGTGG + Intergenic
1153922819 18:9806422-9806444 AGGGGCCTTGAGGATGCTGGTGG + Intronic
1155097512 18:22572423-22572445 AGAACCTTTGTGAACCCTGGGGG - Intergenic
1155233089 18:23793345-23793367 TGGGGCCTTGCTGACCCTGGAGG - Intronic
1157331641 18:46708435-46708457 TGGGGCCTTGCTGACCCTGGAGG + Intronic
1157802962 18:50635848-50635870 GGGGCCTTTGTGAACCATGGAGG - Intronic
1160388327 18:78511732-78511754 AGTGGGGATGTGAACCCTGGGGG - Intergenic
1160960506 19:1718724-1718746 AGGGGCGTCGGGAGCCCTGGAGG - Intergenic
1161510756 19:4669929-4669951 CGGGGCCTTGTGGGCCCCGGCGG - Intronic
1163102775 19:15107879-15107901 AGGGGCATCGGGAGCCCTGGAGG + Intronic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164976389 19:32575858-32575880 TGGGGCCTTGCTGACCCTGGAGG + Intergenic
1165329588 19:35134252-35134274 AGGGTCCTTGTCAAGCCAGGAGG - Intronic
1168386064 19:55964143-55964165 AGGGGCCATGTGATGCCTGGTGG - Intronic
925266805 2:2571542-2571564 AGGGGCCTTGTCACCCCTGCCGG + Intergenic
925913640 2:8589008-8589030 AGAGGCATTGTTACCCCTGGAGG + Intergenic
926344896 2:11936104-11936126 TGGGGCCTTGCTGACCCTGGAGG - Intergenic
926927477 2:18002083-18002105 AGGGCCCATGTGCGCCCTGGGGG + Intronic
929044969 2:37780267-37780289 AGGGGTCTTGTGAGATCTGGTGG + Intergenic
930327121 2:49933925-49933947 AGAGGCCTTGTGAATTCAGGTGG + Intronic
931156306 2:59634733-59634755 AGGGGCCTGGGGAAGCCTCGTGG - Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
934041464 2:88130665-88130687 AGGGACCTGGGGAACCCTGTAGG - Intergenic
935652439 2:105393612-105393634 AGGGGCTTTGTGAATACTTGTGG + Intronic
936901942 2:117491141-117491163 TGGGGCCTTGGGAACCCAGGAGG - Intergenic
937265471 2:120612360-120612382 CGGGGCCTTCTGAGCCCTGCTGG - Intergenic
937972377 2:127560590-127560612 ACAGGCCTTGAGAAGCCTGGCGG + Intronic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
942350474 2:175047364-175047386 AGGAGAATTGTGAACCCCGGGGG + Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
948384391 2:237572656-237572678 AGGGGCCCAGTGGACCCAGGTGG + Intergenic
1169218542 20:3807283-3807305 AGGGGACTTCTGAACCCTTGAGG - Intergenic
1170029686 20:11931842-11931864 AGGGGCCCCGTGAAGCCTAGTGG - Intergenic
1171288121 20:23959625-23959647 AGGAGCATTGTAAACCCTGCTGG - Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1172115782 20:32572736-32572758 TGGGGCCCTGTCAATCCTGGAGG + Intronic
1172196438 20:33095062-33095084 AAGGGCCACGTGAATCCTGGAGG - Intronic
1172244845 20:33438755-33438777 TGGGGCCTTCTGAGGCCTGGGGG + Intronic
1172300136 20:33844032-33844054 AGAGGCTGTGTGAACCCTGCAGG + Intronic
1172446202 20:34994702-34994724 AAGGGCCATGGGAACCCAGGTGG + Intronic
1173433336 20:43010884-43010906 AGGGGACTTGTGAACCTGAGTGG - Intronic
1173521801 20:43705415-43705437 ATGGGCCTTGGGACCACTGGTGG + Intronic
1174373833 20:50112670-50112692 AGGGGCCTTGGGATGTCTGGAGG - Intronic
1175810819 20:61856486-61856508 AGGGCCCTCGTGGATCCTGGGGG - Intronic
1176042736 20:63073773-63073795 GGTGGCCTTGTGCACCCTGGGGG + Intergenic
1176215349 20:63945180-63945202 AGAGGCCTTGTGGAGGCTGGGGG + Intronic
1178562978 21:33656623-33656645 GGGGACCGTTTGAACCCTGGAGG - Intronic
1179658537 21:42860422-42860444 AGGGGCCTTGTCACCCTTGTAGG - Intronic
1180202449 21:46232988-46233010 AGGGGTCTTGGGAACCCAGAAGG - Intergenic
1181009392 22:20031716-20031738 AGGGACCTCTTGCACCCTGGCGG + Intronic
1181277043 22:21693881-21693903 AGCGGCTGTGTGAAGCCTGGGGG + Intronic
1181329103 22:22075261-22075283 AGGGGACTGGTGAAGCCTGAGGG - Intergenic
1182148796 22:28014218-28014240 AGGAGCCTTGTGCCCCCAGGAGG + Intronic
1182718197 22:32376754-32376776 AGGGGACTGCTGAAGCCTGGGGG - Intronic
1183324147 22:37182504-37182526 AGGGTCTTTGTGAACCTTGATGG - Exonic
1185296912 22:50058896-50058918 AGGGGCCGTGTGGACCTGGGTGG - Intergenic
950153125 3:10703736-10703758 TGGGGCCTTGCTAACCCTGGAGG + Intronic
950450304 3:13061551-13061573 AGGGGCTCTGTGGACCTTGGTGG - Intronic
951166009 3:19485884-19485906 AAGGGCCTGTTAAACCCTGGGGG - Intronic
954917556 3:54161980-54162002 TGGAGCCTGGTGAATCCTGGAGG + Intronic
954931031 3:54281413-54281435 AGAGGCCTGGTGAACCCTCCCGG + Intronic
956876743 3:73471304-73471326 ACGTTCCTTGTGAAACCTGGGGG - Intronic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961326970 3:126114703-126114725 AGGGGCATTGGGACCCCAGGTGG + Intronic
961872197 3:129996634-129996656 TGGGGTCTTGGTAACCCTGGAGG - Intergenic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
962420550 3:135225305-135225327 TCGGGCCTTGTTGACCCTGGAGG - Intronic
964335070 3:155646161-155646183 TGGGGCCTTGTTGATCCTGGAGG - Intronic
964659236 3:159101444-159101466 AGGTGCTCTGTGAACACTGGTGG + Intronic
967789693 3:193533912-193533934 AGGAGCCTTGTTAATGCTGGTGG - Intronic
968453084 4:684197-684219 AGGGGCACTGGGAGCCCTGGGGG + Intronic
969734217 4:8976213-8976235 AAGGGCCTCTTGAACTCTGGGGG + Intergenic
969749920 4:9102238-9102260 AAGGGCCTACTGAACCCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
970431087 4:15989892-15989914 AGGGGCCCTGTGTAGCCAGGAGG + Intronic
970583612 4:17494928-17494950 AAGGGCCTTGGAAACCATGGAGG + Intronic
981085137 4:140675911-140675933 GGGGGCCTTGCTGACCCTGGAGG + Intronic
984672995 4:182513700-182513722 TGGGGCCTTGCTGACCCTGGAGG + Intronic
985626581 5:991978-992000 AGGGGGCTTCTGGAACCTGGTGG + Intergenic
994195613 5:96919888-96919910 ATGGGCCTTGTGAAGAATGGGGG - Intronic
997028785 5:130097912-130097934 AGGAGACTGGTGAACCCGGGAGG + Intronic
998049721 5:139022270-139022292 AGGGGCCCTGTGGAATCTGGAGG - Intronic
998169417 5:139863862-139863884 AGGGGCATAGAGACCCCTGGGGG - Intronic
998416701 5:141951453-141951475 AGGGGCCTTGAGATGCCTGTGGG + Intronic
998642510 5:144027208-144027230 TAGAGCCTTGTTAACCCTGGAGG - Intergenic
1001097744 5:168788996-168789018 AGGGGTCTTGGAACCCCTGGTGG + Intronic
1001537542 5:172508711-172508733 AGGGGCCTTGGGGATCTTGGGGG + Intergenic
1001961673 5:175883594-175883616 AGGGGCCTGTGGAACCCTAGAGG - Exonic
1003150072 6:3540728-3540750 AGTGGCCATGTCAACCCGGGGGG - Intergenic
1003403746 6:5811416-5811438 TGGGGCCTTGCTGACCCTGGGGG + Intergenic
1006107100 6:31723423-31723445 AGGGCCCAAGGGAACCCTGGGGG + Exonic
1007357835 6:41333829-41333851 TGGGGCCTTGAGCACCCTAGGGG - Intergenic
1009757764 6:67961955-67961977 AGGAGCCTTGAGAATCCTTGAGG + Intergenic
1010010226 6:71040376-71040398 AGAGACCATGTGAACCCAGGAGG - Intergenic
1015136065 6:129872233-129872255 AGGGGTCTTGTGACTCTTGGAGG + Intergenic
1016907868 6:149169313-149169335 CGGAGCCTTGTGTCCCCTGGAGG - Intergenic
1017776366 6:157684139-157684161 GGGTGCCTTGAGAAGCCTGGGGG - Intergenic
1018736430 6:166690061-166690083 AGGGGCTCTGGGAGCCCTGGAGG + Intronic
1019371723 7:665520-665542 AGGGGCCACGTGAGCCCGGGAGG - Intronic
1019772911 7:2894974-2894996 AGGGGCCTTGTTGACCCCAGGGG + Intergenic
1019920428 7:4159639-4159661 AGGGCCCTAGTGAGCCCTGCTGG + Intronic
1020142526 7:5620507-5620529 AGGGGCCTGGAGAACCAGGGTGG + Intronic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1021932962 7:25599716-25599738 AGGCCCCTGGTGCACCCTGGAGG + Intergenic
1023909738 7:44545075-44545097 AGGGGCCCTGTGATCCCCGTGGG + Intergenic
1023991190 7:45129890-45129912 AGGGTCTTTGGGACCCCTGGGGG - Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1032075364 7:128833396-128833418 AGTGGCTTGGTGAGCCCTGGTGG + Intronic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036558801 8:9884183-9884205 AAGGCCCCTGGGAACCCTGGAGG + Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1037880906 8:22572957-22572979 AGAGGCCATGTGAAGCCTGGTGG - Intronic
1038534928 8:28347138-28347160 AGGGGCCAAGGGAGCCCTGGTGG + Exonic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1040850706 8:51898668-51898690 AGGGGCCCAGCGAAGCCTGGAGG - Intronic
1040877189 8:52166221-52166243 TGGGGCCTTGCTAACTCTGGAGG + Intronic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1046431739 8:114135854-114135876 AGGGGCCTGGGGACCCCTTGAGG - Intergenic
1049613813 8:143567757-143567779 AGGGGCAGTGTGACCCCGGGCGG + Intronic
1052340159 9:27357309-27357331 AGGGGCCTTGTTGATCCTGGAGG + Intronic
1055716181 9:79120711-79120733 AGGCTGCCTGTGAACCCTGGGGG + Intergenic
1056537860 9:87546570-87546592 TGAGGCCTTGTTGACCCTGGAGG - Intronic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1057193403 9:93099898-93099920 AGGGGCCCTGTGAACCAGGATGG + Intronic
1058942291 9:109824213-109824235 AGTGGCCTTGGAAACCCTTGTGG - Intronic
1060477757 9:123998938-123998960 AGGGGCTTTAGGGACCCTGGAGG + Intergenic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1062240326 9:135534201-135534223 TGGAGCCTTGCTAACCCTGGAGG + Intergenic
1062433249 9:136535246-136535268 AGGGGCCTTGTGAACCCTGGGGG - Intronic
1062633668 9:137478723-137478745 GGGGGCTCAGTGAACCCTGGGGG - Intronic
1187237843 X:17484868-17484890 TGGGGCCTTGTTCACCCTAGAGG - Intronic
1187605275 X:20875319-20875341 AGGTGCCTGGTGACCCCTGTTGG - Intergenic
1192497120 X:71623309-71623331 TGGGGCCTTGGGAGCCCAGGAGG + Intergenic
1195570507 X:106394207-106394229 AGGGGCCTTATGATCAATGGAGG + Intergenic
1198099022 X:133407715-133407737 CTGGGCCTTGTGAAACCTAGTGG + Intronic
1200142363 X:153908477-153908499 ATGGGCCCTGTGAACACTGTCGG - Intronic