ID: 1062435577

View in Genome Browser
Species Human (GRCh38)
Location 9:136545408-136545430
Sequence CCGCGCGTGGGGCTTGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062435577_1062435587 -8 Left 1062435577 9:136545408-136545430 CCGGCGGCAAGCCCCACGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1062435587 9:136545423-136545445 ACGCGCGGCGGGTGAAGGGCGGG No data
1062435577_1062435591 11 Left 1062435577 9:136545408-136545430 CCGGCGGCAAGCCCCACGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1062435591 9:136545442-136545464 CGGGCCCGGAGTAGGGCCTCCGG No data
1062435577_1062435589 3 Left 1062435577 9:136545408-136545430 CCGGCGGCAAGCCCCACGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1062435589 9:136545434-136545456 GTGAAGGGCGGGCCCGGAGTAGG No data
1062435577_1062435592 12 Left 1062435577 9:136545408-136545430 CCGGCGGCAAGCCCCACGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1062435592 9:136545443-136545465 GGGCCCGGAGTAGGGCCTCCGGG No data
1062435577_1062435588 -3 Left 1062435577 9:136545408-136545430 CCGGCGGCAAGCCCCACGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1062435588 9:136545428-136545450 CGGCGGGTGAAGGGCGGGCCCGG No data
1062435577_1062435586 -9 Left 1062435577 9:136545408-136545430 CCGGCGGCAAGCCCCACGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1062435586 9:136545422-136545444 CACGCGCGGCGGGTGAAGGGCGG No data
1062435577_1062435593 13 Left 1062435577 9:136545408-136545430 CCGGCGGCAAGCCCCACGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1062435593 9:136545444-136545466 GGCCCGGAGTAGGGCCTCCGGGG No data
1062435577_1062435590 4 Left 1062435577 9:136545408-136545430 CCGGCGGCAAGCCCCACGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1062435590 9:136545435-136545457 TGAAGGGCGGGCCCGGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062435577 Original CRISPR CCGCGCGTGGGGCTTGCCGC CGG (reversed) Intronic
901066597 1:6497339-6497361 CCGCGCGGGGGGCGGGCGGCGGG + Intronic
924801522 1:247332019-247332041 GCGCGCCTGGGCCTGGCCGCCGG + Intergenic
1064218511 10:13419976-13419998 CCCCGCGTGGCCCTTGCAGCTGG + Intergenic
1072757282 10:98029887-98029909 CCGCGCGCGGGGCTGGCTCCCGG + Intronic
1076750127 10:132538186-132538208 CCGGGCTTGGGGCCTGCCGCCGG - Intronic
1077103649 11:832873-832895 CCGCGGGAGGGGCTTGAGGCCGG + Exonic
1077158990 11:1104101-1104123 CAGCGCGTGGGGCCTGGCGCTGG + Intergenic
1078164474 11:8870806-8870828 ACGCGCGTGGGGGCCGCCGCAGG - Intronic
1092046883 12:5437628-5437650 CCGCGGGTGAGGCTTGAGGCAGG - Intronic
1098595885 12:72272795-72272817 CCGCGCTTCGGGCTGGCAGCAGG + Exonic
1103961501 12:124611741-124611763 CCGCCCCTGGGGCCTGCCTCTGG + Intergenic
1104908720 12:132229292-132229314 CGCCTCGTGGGGCTTGCCTCTGG - Intronic
1105024801 12:132840748-132840770 CCGAGCCTGGGGCTGGACGCAGG - Intronic
1105024817 12:132840811-132840833 CCGAGCCTGGGGCTGGACGCAGG - Intronic
1112504858 13:99969617-99969639 CCGGGCGTGGGATTTGCTGCCGG - Intronic
1114669036 14:24399115-24399137 CCGTGCGGGGGGCGCGCCGCGGG + Intronic
1122521650 14:102348363-102348385 CACCACGTGGGGCTGGCCGCGGG + Exonic
1122957200 14:105076378-105076400 CCCGGGGTGGGGCGTGCCGCGGG - Intergenic
1124613261 15:31223607-31223629 CGGCGCGTGGGGGGTGCTGCAGG + Intergenic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1129320493 15:74772066-74772088 CCTTGCGTGGGGCCTGGCGCGGG - Intergenic
1132683941 16:1154428-1154450 CCCCGCGAGGGGCCTGCCTCGGG - Intronic
1139676947 16:68530292-68530314 CCGCGCTCGGGGCTGGCGGCGGG - Intronic
1147243709 17:39107304-39107326 CCAGGCATGGGGCTTGCTGCTGG - Intronic
1150588532 17:66540374-66540396 CCTGGAGTGGGGCTTGACGCTGG + Intronic
1160739727 19:680236-680258 ACGCGCGTGGGGCCGGGCGCGGG - Intronic
1163243180 19:16076643-16076665 CCGCGCGCAGGGCCTGCAGCGGG + Intronic
1163850991 19:19663551-19663573 CCGCGCGCGCTCCTTGCCGCCGG - Exonic
1164647984 19:29873237-29873259 CCCAGCGCGGGCCTTGCCGCGGG + Intergenic
1167664881 19:50818208-50818230 CCGCGGGTGGGCCGTGCAGCAGG + Intergenic
935595356 2:104873506-104873528 GCGCGCGCGGGGCTGGCCACAGG - Intergenic
936531124 2:113277786-113277808 CCGCGCGCGGGGCGTCCGGCTGG - Intronic
937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG + Exonic
1169048777 20:2558982-2559004 CCGCGCGGGGGAGTGGCCGCGGG + Intronic
1173245863 20:41336991-41337013 CAGCACGTGGGACTTGCTGCCGG - Intergenic
1175340945 20:58228620-58228642 CCGCGCCTGGGGGATGCGGCGGG - Exonic
1180092808 21:45541746-45541768 CCACGCGTGGGGCGGGCCCCTGG - Intronic
1181276137 22:21688495-21688517 CCCCGCCTGGGGCCTGCCCCGGG - Intronic
1184361973 22:44024314-44024336 CCGCGCGTGGGGCCGGCGGCGGG - Intronic
952990881 3:38829690-38829712 CAGCGCATGGGGCTGGCAGCTGG + Intergenic
954199882 3:49017934-49017956 CCGCCCGTGGGGACTGCGGCTGG - Intronic
966711999 3:182980677-182980699 CCCCGCGCGGGGCTTCCCCCGGG + Intronic
968548355 4:1210059-1210081 CCGAGGGTGGGGCTGGCCTCTGG - Intergenic
968657818 4:1786177-1786199 CAGAGCGTGGGGCTGGCCACAGG + Intergenic
981073526 4:140569035-140569057 CCGGGCGTGGGACCTGCCGGGGG + Intergenic
995650461 5:114362632-114362654 CTGCCCGTGGGGCTGGCGGCGGG - Exonic
1002043842 5:176531411-176531433 CTGTGCCTGGGGCTTGCAGCTGG + Intronic
1003146374 6:3513610-3513632 CTGGGCGAGGGGCCTGCCGCGGG + Intergenic
1005959963 6:30687384-30687406 CCCCGCGTGGGACTCGCTGCGGG + Exonic
1019595537 7:1856732-1856754 GTGCGCGTGGGCCCTGCCGCTGG - Intronic
1029139830 7:98401480-98401502 CCTCGCGTGGTGCTGGCCCCGGG + Intergenic
1034296022 7:149973068-149973090 CCGCTCGTGGGGCTTACCTGGGG - Intergenic
1034810008 7:154123741-154123763 CCGCTCGTGGGGCTTACCTGGGG + Intronic
1034810028 7:154123835-154123857 CCGCTCGTGGGGCTTACCTGGGG + Intronic
1039905808 8:41785698-41785720 CCGGGCCTGGGCCTTCCCGCAGG + Intronic
1045516257 8:102863500-102863522 GCGCGCGGGGGTCTCGCCGCCGG - Intronic
1049195889 8:141315426-141315448 CAGCAGGTGGGGCCTGCCGCAGG - Intergenic
1060044897 9:120332158-120332180 CTGCGGGTGGGGCGTGCTGCTGG - Intergenic
1060484918 9:124040915-124040937 CCGGGCATGGGGGTGGCCGCGGG + Intergenic
1060897003 9:127224854-127224876 CCCCGCGGGGTTCTTGCCGCCGG - Intronic
1062390703 9:136332611-136332633 CCGTGCGTGGCGCTGGCTGCAGG + Intronic
1062435577 9:136545408-136545430 CCGCGCGTGGGGCTTGCCGCCGG - Intronic
1201295209 Y:12456237-12456259 CCGAGCGTGGGGTTTCCTGCAGG + Intergenic