ID: 1062436862

View in Genome Browser
Species Human (GRCh38)
Location 9:136550236-136550258
Sequence AGCAAACCTTCCGGAGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062436862_1062436865 7 Left 1062436862 9:136550236-136550258 CCAGAGGCTCCGGAAGGTTTGCT No data
Right 1062436865 9:136550266-136550288 CTGTGACTGCAAGAAGCTGAAGG No data
1062436862_1062436869 30 Left 1062436862 9:136550236-136550258 CCAGAGGCTCCGGAAGGTTTGCT No data
Right 1062436869 9:136550289-136550311 AATGTGGGCGCAGACCCGGCAGG No data
1062436862_1062436867 15 Left 1062436862 9:136550236-136550258 CCAGAGGCTCCGGAAGGTTTGCT No data
Right 1062436867 9:136550274-136550296 GCAAGAAGCTGAAGGAATGTGGG No data
1062436862_1062436868 26 Left 1062436862 9:136550236-136550258 CCAGAGGCTCCGGAAGGTTTGCT No data
Right 1062436868 9:136550285-136550307 AAGGAATGTGGGCGCAGACCCGG No data
1062436862_1062436866 14 Left 1062436862 9:136550236-136550258 CCAGAGGCTCCGGAAGGTTTGCT No data
Right 1062436866 9:136550273-136550295 TGCAAGAAGCTGAAGGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062436862 Original CRISPR AGCAAACCTTCCGGAGCCTC TGG (reversed) Intergenic