ID: 1062436863

View in Genome Browser
Species Human (GRCh38)
Location 9:136550245-136550267
Sequence AGGTCAGTCAGCAAACCTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062436863_1062436865 -2 Left 1062436863 9:136550245-136550267 CCGGAAGGTTTGCTGACTGACCT No data
Right 1062436865 9:136550266-136550288 CTGTGACTGCAAGAAGCTGAAGG No data
1062436863_1062436869 21 Left 1062436863 9:136550245-136550267 CCGGAAGGTTTGCTGACTGACCT No data
Right 1062436869 9:136550289-136550311 AATGTGGGCGCAGACCCGGCAGG No data
1062436863_1062436871 23 Left 1062436863 9:136550245-136550267 CCGGAAGGTTTGCTGACTGACCT No data
Right 1062436871 9:136550291-136550313 TGTGGGCGCAGACCCGGCAGGGG No data
1062436863_1062436866 5 Left 1062436863 9:136550245-136550267 CCGGAAGGTTTGCTGACTGACCT No data
Right 1062436866 9:136550273-136550295 TGCAAGAAGCTGAAGGAATGTGG No data
1062436863_1062436870 22 Left 1062436863 9:136550245-136550267 CCGGAAGGTTTGCTGACTGACCT No data
Right 1062436870 9:136550290-136550312 ATGTGGGCGCAGACCCGGCAGGG No data
1062436863_1062436867 6 Left 1062436863 9:136550245-136550267 CCGGAAGGTTTGCTGACTGACCT No data
Right 1062436867 9:136550274-136550296 GCAAGAAGCTGAAGGAATGTGGG No data
1062436863_1062436868 17 Left 1062436863 9:136550245-136550267 CCGGAAGGTTTGCTGACTGACCT No data
Right 1062436868 9:136550285-136550307 AAGGAATGTGGGCGCAGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062436863 Original CRISPR AGGTCAGTCAGCAAACCTTC CGG (reversed) Intergenic