ID: 1062436864

View in Genome Browser
Species Human (GRCh38)
Location 9:136550265-136550287
Sequence CTTCAGCTTCTTGCAGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062436864_1062436875 28 Left 1062436864 9:136550265-136550287 CCTGTGACTGCAAGAAGCTGAAG No data
Right 1062436875 9:136550316-136550338 TTTCTTGGTGCAAAGTCAACTGG No data
1062436864_1062436869 1 Left 1062436864 9:136550265-136550287 CCTGTGACTGCAAGAAGCTGAAG No data
Right 1062436869 9:136550289-136550311 AATGTGGGCGCAGACCCGGCAGG No data
1062436864_1062436870 2 Left 1062436864 9:136550265-136550287 CCTGTGACTGCAAGAAGCTGAAG No data
Right 1062436870 9:136550290-136550312 ATGTGGGCGCAGACCCGGCAGGG No data
1062436864_1062436872 13 Left 1062436864 9:136550265-136550287 CCTGTGACTGCAAGAAGCTGAAG No data
Right 1062436872 9:136550301-136550323 GACCCGGCAGGGGCTTTTCTTGG No data
1062436864_1062436871 3 Left 1062436864 9:136550265-136550287 CCTGTGACTGCAAGAAGCTGAAG No data
Right 1062436871 9:136550291-136550313 TGTGGGCGCAGACCCGGCAGGGG No data
1062436864_1062436868 -3 Left 1062436864 9:136550265-136550287 CCTGTGACTGCAAGAAGCTGAAG No data
Right 1062436868 9:136550285-136550307 AAGGAATGTGGGCGCAGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062436864 Original CRISPR CTTCAGCTTCTTGCAGTCAC AGG (reversed) Intergenic