ID: 1062436871

View in Genome Browser
Species Human (GRCh38)
Location 9:136550291-136550313
Sequence TGTGGGCGCAGACCCGGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062436863_1062436871 23 Left 1062436863 9:136550245-136550267 CCGGAAGGTTTGCTGACTGACCT No data
Right 1062436871 9:136550291-136550313 TGTGGGCGCAGACCCGGCAGGGG No data
1062436864_1062436871 3 Left 1062436864 9:136550265-136550287 CCTGTGACTGCAAGAAGCTGAAG No data
Right 1062436871 9:136550291-136550313 TGTGGGCGCAGACCCGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062436871 Original CRISPR TGTGGGCGCAGACCCGGCAG GGG Intergenic