ID: 1062436872 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:136550301-136550323 |
| Sequence | GACCCGGCAGGGGCTTTTCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1062436864_1062436872 | 13 | Left | 1062436864 | 9:136550265-136550287 | CCTGTGACTGCAAGAAGCTGAAG | No data | ||
| Right | 1062436872 | 9:136550301-136550323 | GACCCGGCAGGGGCTTTTCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1062436872 | Original CRISPR | GACCCGGCAGGGGCTTTTCT TGG | Intergenic | ||