ID: 1062436876

View in Genome Browser
Species Human (GRCh38)
Location 9:136550342-136550364
Sequence TCCATGCAAGCCTGCTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062436873_1062436876 16 Left 1062436873 9:136550303-136550325 CCCGGCAGGGGCTTTTCTTGGTG No data
Right 1062436876 9:136550342-136550364 TCCATGCAAGCCTGCTGCTGTGG No data
1062436874_1062436876 15 Left 1062436874 9:136550304-136550326 CCGGCAGGGGCTTTTCTTGGTGC No data
Right 1062436876 9:136550342-136550364 TCCATGCAAGCCTGCTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062436876 Original CRISPR TCCATGCAAGCCTGCTGCTG TGG Intergenic