ID: 1062438270

View in Genome Browser
Species Human (GRCh38)
Location 9:136556739-136556761
Sequence TCCTGGGCCCACTGCAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062438270_1062438281 20 Left 1062438270 9:136556739-136556761 CCCCATCTGCAGTGGGCCCAGGA No data
Right 1062438281 9:136556782-136556804 AGTGGTGGGATTGTATTTCTGGG No data
1062438270_1062438278 5 Left 1062438270 9:136556739-136556761 CCCCATCTGCAGTGGGCCCAGGA No data
Right 1062438278 9:136556767-136556789 GCAACAGGACTTAGCAGTGGTGG No data
1062438270_1062438277 2 Left 1062438270 9:136556739-136556761 CCCCATCTGCAGTGGGCCCAGGA No data
Right 1062438277 9:136556764-136556786 ATAGCAACAGGACTTAGCAGTGG No data
1062438270_1062438274 -10 Left 1062438270 9:136556739-136556761 CCCCATCTGCAGTGGGCCCAGGA No data
Right 1062438274 9:136556752-136556774 GGGCCCAGGAGGATAGCAACAGG No data
1062438270_1062438280 19 Left 1062438270 9:136556739-136556761 CCCCATCTGCAGTGGGCCCAGGA No data
Right 1062438280 9:136556781-136556803 CAGTGGTGGGATTGTATTTCTGG No data
1062438270_1062438279 6 Left 1062438270 9:136556739-136556761 CCCCATCTGCAGTGGGCCCAGGA No data
Right 1062438279 9:136556768-136556790 CAACAGGACTTAGCAGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062438270 Original CRISPR TCCTGGGCCCACTGCAGATG GGG (reversed) Intergenic
No off target data available for this crispr