ID: 1062438274

View in Genome Browser
Species Human (GRCh38)
Location 9:136556752-136556774
Sequence GGGCCCAGGAGGATAGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062438262_1062438274 18 Left 1062438262 9:136556711-136556733 CCAGGGGGATCCGCGGGTGGCAG No data
Right 1062438274 9:136556752-136556774 GGGCCCAGGAGGATAGCAACAGG No data
1062438266_1062438274 8 Left 1062438266 9:136556721-136556743 CCGCGGGTGGCAGGGTGGCCCCA No data
Right 1062438274 9:136556752-136556774 GGGCCCAGGAGGATAGCAACAGG No data
1062438270_1062438274 -10 Left 1062438270 9:136556739-136556761 CCCCATCTGCAGTGGGCCCAGGA No data
Right 1062438274 9:136556752-136556774 GGGCCCAGGAGGATAGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062438274 Original CRISPR GGGCCCAGGAGGATAGCAAC AGG Intergenic
No off target data available for this crispr