ID: 1062438277

View in Genome Browser
Species Human (GRCh38)
Location 9:136556764-136556786
Sequence ATAGCAACAGGACTTAGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062438266_1062438277 20 Left 1062438266 9:136556721-136556743 CCGCGGGTGGCAGGGTGGCCCCA No data
Right 1062438277 9:136556764-136556786 ATAGCAACAGGACTTAGCAGTGG No data
1062438262_1062438277 30 Left 1062438262 9:136556711-136556733 CCAGGGGGATCCGCGGGTGGCAG No data
Right 1062438277 9:136556764-136556786 ATAGCAACAGGACTTAGCAGTGG No data
1062438270_1062438277 2 Left 1062438270 9:136556739-136556761 CCCCATCTGCAGTGGGCCCAGGA No data
Right 1062438277 9:136556764-136556786 ATAGCAACAGGACTTAGCAGTGG No data
1062438271_1062438277 1 Left 1062438271 9:136556740-136556762 CCCATCTGCAGTGGGCCCAGGAG No data
Right 1062438277 9:136556764-136556786 ATAGCAACAGGACTTAGCAGTGG No data
1062438272_1062438277 0 Left 1062438272 9:136556741-136556763 CCATCTGCAGTGGGCCCAGGAGG No data
Right 1062438277 9:136556764-136556786 ATAGCAACAGGACTTAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062438277 Original CRISPR ATAGCAACAGGACTTAGCAG TGG Intergenic
No off target data available for this crispr