ID: 1062438278

View in Genome Browser
Species Human (GRCh38)
Location 9:136556767-136556789
Sequence GCAACAGGACTTAGCAGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062438272_1062438278 3 Left 1062438272 9:136556741-136556763 CCATCTGCAGTGGGCCCAGGAGG No data
Right 1062438278 9:136556767-136556789 GCAACAGGACTTAGCAGTGGTGG No data
1062438266_1062438278 23 Left 1062438266 9:136556721-136556743 CCGCGGGTGGCAGGGTGGCCCCA No data
Right 1062438278 9:136556767-136556789 GCAACAGGACTTAGCAGTGGTGG No data
1062438270_1062438278 5 Left 1062438270 9:136556739-136556761 CCCCATCTGCAGTGGGCCCAGGA No data
Right 1062438278 9:136556767-136556789 GCAACAGGACTTAGCAGTGGTGG No data
1062438271_1062438278 4 Left 1062438271 9:136556740-136556762 CCCATCTGCAGTGGGCCCAGGAG No data
Right 1062438278 9:136556767-136556789 GCAACAGGACTTAGCAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062438278 Original CRISPR GCAACAGGACTTAGCAGTGG TGG Intergenic
No off target data available for this crispr