ID: 1062438280

View in Genome Browser
Species Human (GRCh38)
Location 9:136556781-136556803
Sequence CAGTGGTGGGATTGTATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062438272_1062438280 17 Left 1062438272 9:136556741-136556763 CCATCTGCAGTGGGCCCAGGAGG No data
Right 1062438280 9:136556781-136556803 CAGTGGTGGGATTGTATTTCTGG No data
1062438276_1062438280 2 Left 1062438276 9:136556756-136556778 CCAGGAGGATAGCAACAGGACTT No data
Right 1062438280 9:136556781-136556803 CAGTGGTGGGATTGTATTTCTGG No data
1062438271_1062438280 18 Left 1062438271 9:136556740-136556762 CCCATCTGCAGTGGGCCCAGGAG No data
Right 1062438280 9:136556781-136556803 CAGTGGTGGGATTGTATTTCTGG No data
1062438275_1062438280 3 Left 1062438275 9:136556755-136556777 CCCAGGAGGATAGCAACAGGACT No data
Right 1062438280 9:136556781-136556803 CAGTGGTGGGATTGTATTTCTGG No data
1062438270_1062438280 19 Left 1062438270 9:136556739-136556761 CCCCATCTGCAGTGGGCCCAGGA No data
Right 1062438280 9:136556781-136556803 CAGTGGTGGGATTGTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062438280 Original CRISPR CAGTGGTGGGATTGTATTTC TGG Intergenic
No off target data available for this crispr