ID: 1062438317

View in Genome Browser
Species Human (GRCh38)
Location 9:136556910-136556932
Sequence CCCTTTGAGGAGATGGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062438317_1062438328 10 Left 1062438317 9:136556910-136556932 CCCAGGTCCATCTCCTCAAAGGG No data
Right 1062438328 9:136556943-136556965 CCCTCACGCGGCTGCACACAAGG No data
1062438317_1062438322 -2 Left 1062438317 9:136556910-136556932 CCCAGGTCCATCTCCTCAAAGGG No data
Right 1062438322 9:136556931-136556953 GGACCCACCAGCCCCTCACGCGG No data
1062438317_1062438330 24 Left 1062438317 9:136556910-136556932 CCCAGGTCCATCTCCTCAAAGGG No data
Right 1062438330 9:136556957-136556979 CACACAAGGCAGTCCCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062438317 Original CRISPR CCCTTTGAGGAGATGGACCT GGG (reversed) Intergenic
No off target data available for this crispr