ID: 1062438322

View in Genome Browser
Species Human (GRCh38)
Location 9:136556931-136556953
Sequence GGACCCACCAGCCCCTCACG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062438313_1062438322 21 Left 1062438313 9:136556887-136556909 CCTCACCAGACAGAGGGGAGGAG No data
Right 1062438322 9:136556931-136556953 GGACCCACCAGCCCCTCACGCGG No data
1062438319_1062438322 -3 Left 1062438319 9:136556911-136556933 CCAGGTCCATCTCCTCAAAGGGA No data
Right 1062438322 9:136556931-136556953 GGACCCACCAGCCCCTCACGCGG No data
1062438314_1062438322 16 Left 1062438314 9:136556892-136556914 CCAGACAGAGGGGAGGAGCCCAG No data
Right 1062438322 9:136556931-136556953 GGACCCACCAGCCCCTCACGCGG No data
1062438317_1062438322 -2 Left 1062438317 9:136556910-136556932 CCCAGGTCCATCTCCTCAAAGGG No data
Right 1062438322 9:136556931-136556953 GGACCCACCAGCCCCTCACGCGG No data
1062438320_1062438322 -9 Left 1062438320 9:136556917-136556939 CCATCTCCTCAAAGGGACCCACC No data
Right 1062438322 9:136556931-136556953 GGACCCACCAGCCCCTCACGCGG No data
1062438312_1062438322 22 Left 1062438312 9:136556886-136556908 CCCTCACCAGACAGAGGGGAGGA No data
Right 1062438322 9:136556931-136556953 GGACCCACCAGCCCCTCACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062438322 Original CRISPR GGACCCACCAGCCCCTCACG CGG Intergenic
No off target data available for this crispr