ID: 1062438328

View in Genome Browser
Species Human (GRCh38)
Location 9:136556943-136556965
Sequence CCCTCACGCGGCTGCACACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062438320_1062438328 3 Left 1062438320 9:136556917-136556939 CCATCTCCTCAAAGGGACCCACC No data
Right 1062438328 9:136556943-136556965 CCCTCACGCGGCTGCACACAAGG No data
1062438319_1062438328 9 Left 1062438319 9:136556911-136556933 CCAGGTCCATCTCCTCAAAGGGA No data
Right 1062438328 9:136556943-136556965 CCCTCACGCGGCTGCACACAAGG No data
1062438321_1062438328 -3 Left 1062438321 9:136556923-136556945 CCTCAAAGGGACCCACCAGCCCC No data
Right 1062438328 9:136556943-136556965 CCCTCACGCGGCTGCACACAAGG No data
1062438314_1062438328 28 Left 1062438314 9:136556892-136556914 CCAGACAGAGGGGAGGAGCCCAG No data
Right 1062438328 9:136556943-136556965 CCCTCACGCGGCTGCACACAAGG No data
1062438317_1062438328 10 Left 1062438317 9:136556910-136556932 CCCAGGTCCATCTCCTCAAAGGG No data
Right 1062438328 9:136556943-136556965 CCCTCACGCGGCTGCACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062438328 Original CRISPR CCCTCACGCGGCTGCACACA AGG Intergenic
No off target data available for this crispr