ID: 1062438330

View in Genome Browser
Species Human (GRCh38)
Location 9:136556957-136556979
Sequence CACACAAGGCAGTCCCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062438324_1062438330 -1 Left 1062438324 9:136556935-136556957 CCACCAGCCCCTCACGCGGCTGC No data
Right 1062438330 9:136556957-136556979 CACACAAGGCAGTCCCAGCCAGG No data
1062438320_1062438330 17 Left 1062438320 9:136556917-136556939 CCATCTCCTCAAAGGGACCCACC No data
Right 1062438330 9:136556957-136556979 CACACAAGGCAGTCCCAGCCAGG No data
1062438317_1062438330 24 Left 1062438317 9:136556910-136556932 CCCAGGTCCATCTCCTCAAAGGG No data
Right 1062438330 9:136556957-136556979 CACACAAGGCAGTCCCAGCCAGG No data
1062438325_1062438330 -4 Left 1062438325 9:136556938-136556960 CCAGCCCCTCACGCGGCTGCACA No data
Right 1062438330 9:136556957-136556979 CACACAAGGCAGTCCCAGCCAGG No data
1062438326_1062438330 -8 Left 1062438326 9:136556942-136556964 CCCCTCACGCGGCTGCACACAAG No data
Right 1062438330 9:136556957-136556979 CACACAAGGCAGTCCCAGCCAGG No data
1062438319_1062438330 23 Left 1062438319 9:136556911-136556933 CCAGGTCCATCTCCTCAAAGGGA No data
Right 1062438330 9:136556957-136556979 CACACAAGGCAGTCCCAGCCAGG No data
1062438323_1062438330 0 Left 1062438323 9:136556934-136556956 CCCACCAGCCCCTCACGCGGCTG No data
Right 1062438330 9:136556957-136556979 CACACAAGGCAGTCCCAGCCAGG No data
1062438321_1062438330 11 Left 1062438321 9:136556923-136556945 CCTCAAAGGGACCCACCAGCCCC No data
Right 1062438330 9:136556957-136556979 CACACAAGGCAGTCCCAGCCAGG No data
1062438329_1062438330 -10 Left 1062438329 9:136556944-136556966 CCTCACGCGGCTGCACACAAGGC No data
Right 1062438330 9:136556957-136556979 CACACAAGGCAGTCCCAGCCAGG No data
1062438327_1062438330 -9 Left 1062438327 9:136556943-136556965 CCCTCACGCGGCTGCACACAAGG No data
Right 1062438330 9:136556957-136556979 CACACAAGGCAGTCCCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062438330 Original CRISPR CACACAAGGCAGTCCCAGCC AGG Intergenic
No off target data available for this crispr