ID: 1062439885

View in Genome Browser
Species Human (GRCh38)
Location 9:136564972-136564994
Sequence AGAATCACCGCACACGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062439885_1062439897 23 Left 1062439885 9:136564972-136564994 CCTTCTGCGTGTGCGGTGATTCT No data
Right 1062439897 9:136565018-136565040 GAGCTGGGCATGAGAAACTGAGG No data
1062439885_1062439894 8 Left 1062439885 9:136564972-136564994 CCTTCTGCGTGTGCGGTGATTCT No data
Right 1062439894 9:136565003-136565025 CCAGGCTCCCGGCTGGAGCTGGG No data
1062439885_1062439888 -3 Left 1062439885 9:136564972-136564994 CCTTCTGCGTGTGCGGTGATTCT No data
Right 1062439888 9:136564992-136565014 TCTGGACCTGCCCAGGCTCCCGG No data
1062439885_1062439887 -10 Left 1062439885 9:136564972-136564994 CCTTCTGCGTGTGCGGTGATTCT No data
Right 1062439887 9:136564985-136565007 CGGTGATTCTGGACCTGCCCAGG No data
1062439885_1062439889 1 Left 1062439885 9:136564972-136564994 CCTTCTGCGTGTGCGGTGATTCT No data
Right 1062439889 9:136564996-136565018 GACCTGCCCAGGCTCCCGGCTGG No data
1062439885_1062439892 7 Left 1062439885 9:136564972-136564994 CCTTCTGCGTGTGCGGTGATTCT No data
Right 1062439892 9:136565002-136565024 CCCAGGCTCCCGGCTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062439885 Original CRISPR AGAATCACCGCACACGCAGA AGG (reversed) Intergenic