ID: 1062439973

View in Genome Browser
Species Human (GRCh38)
Location 9:136565350-136565372
Sequence AGAAGGTCCCGGCTCTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062439962_1062439973 20 Left 1062439962 9:136565307-136565329 CCCGGCATCTGTGCACGGCCATG No data
Right 1062439973 9:136565350-136565372 AGAAGGTCCCGGCTCTGTAGAGG No data
1062439960_1062439973 27 Left 1062439960 9:136565300-136565322 CCGCACTCCCGGCATCTGTGCAC No data
Right 1062439973 9:136565350-136565372 AGAAGGTCCCGGCTCTGTAGAGG No data
1062439969_1062439973 -8 Left 1062439969 9:136565335-136565357 CCAGCTCCTTTCCGGAGAAGGTC No data
Right 1062439973 9:136565350-136565372 AGAAGGTCCCGGCTCTGTAGAGG No data
1062439963_1062439973 19 Left 1062439963 9:136565308-136565330 CCGGCATCTGTGCACGGCCATGC No data
Right 1062439973 9:136565350-136565372 AGAAGGTCCCGGCTCTGTAGAGG No data
1062439965_1062439973 2 Left 1062439965 9:136565325-136565347 CCATGCAGGCCCAGCTCCTTTCC No data
Right 1062439973 9:136565350-136565372 AGAAGGTCCCGGCTCTGTAGAGG No data
1062439968_1062439973 -7 Left 1062439968 9:136565334-136565356 CCCAGCTCCTTTCCGGAGAAGGT No data
Right 1062439973 9:136565350-136565372 AGAAGGTCCCGGCTCTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062439973 Original CRISPR AGAAGGTCCCGGCTCTGTAG AGG Intergenic
No off target data available for this crispr