ID: 1062440078

View in Genome Browser
Species Human (GRCh38)
Location 9:136565862-136565884
Sequence CCTGGCCACATGGTGATCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062440063_1062440078 28 Left 1062440063 9:136565811-136565833 CCGTCCTGCAGGGGAAGAGGTGG No data
Right 1062440078 9:136565862-136565884 CCTGGCCACATGGTGATCTATGG No data
1062440065_1062440078 24 Left 1062440065 9:136565815-136565837 CCTGCAGGGGAAGAGGTGGTATG No data
Right 1062440078 9:136565862-136565884 CCTGGCCACATGGTGATCTATGG No data
1062440071_1062440078 -6 Left 1062440071 9:136565845-136565867 CCAGGTTCCGCCCCGGTCCTGGC No data
Right 1062440078 9:136565862-136565884 CCTGGCCACATGGTGATCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062440078 Original CRISPR CCTGGCCACATGGTGATCTA TGG Intergenic
No off target data available for this crispr