ID: 1062441379

View in Genome Browser
Species Human (GRCh38)
Location 9:136571197-136571219
Sequence CCGCTCACCTCCCACGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062441373_1062441379 4 Left 1062441373 9:136571170-136571192 CCGGCCTCTCCTTCTGACGTTTA No data
Right 1062441379 9:136571197-136571219 CCGCTCACCTCCCACGCCCTGGG No data
1062441374_1062441379 0 Left 1062441374 9:136571174-136571196 CCTCTCCTTCTGACGTTTATCGG No data
Right 1062441379 9:136571197-136571219 CCGCTCACCTCCCACGCCCTGGG No data
1062441368_1062441379 30 Left 1062441368 9:136571144-136571166 CCGGGAGCCGTGGTGCTGACTCT No data
Right 1062441379 9:136571197-136571219 CCGCTCACCTCCCACGCCCTGGG No data
1062441376_1062441379 -5 Left 1062441376 9:136571179-136571201 CCTTCTGACGTTTATCGGCCGCT No data
Right 1062441379 9:136571197-136571219 CCGCTCACCTCCCACGCCCTGGG No data
1062441371_1062441379 23 Left 1062441371 9:136571151-136571173 CCGTGGTGCTGACTCTGGGCCGG No data
Right 1062441379 9:136571197-136571219 CCGCTCACCTCCCACGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062441379 Original CRISPR CCGCTCACCTCCCACGCCCT GGG Intergenic
No off target data available for this crispr