ID: 1062443235

View in Genome Browser
Species Human (GRCh38)
Location 9:136582862-136582884
Sequence CCCTTAAGGTGCCTGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062443227_1062443235 0 Left 1062443227 9:136582839-136582861 CCAGCCACACCTTCCTGGCCTTG No data
Right 1062443235 9:136582862-136582884 CCCTTAAGGTGCCTGGAGTCAGG No data
1062443228_1062443235 -4 Left 1062443228 9:136582843-136582865 CCACACCTTCCTGGCCTTGCCCT No data
Right 1062443235 9:136582862-136582884 CCCTTAAGGTGCCTGGAGTCAGG No data
1062443229_1062443235 -9 Left 1062443229 9:136582848-136582870 CCTTCCTGGCCTTGCCCTTAAGG No data
Right 1062443235 9:136582862-136582884 CCCTTAAGGTGCCTGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062443235 Original CRISPR CCCTTAAGGTGCCTGGAGTC AGG Intergenic
No off target data available for this crispr