ID: 1062443378

View in Genome Browser
Species Human (GRCh38)
Location 9:136583443-136583465
Sequence CAGGCTAGGGTTTCTCGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062443378_1062443393 20 Left 1062443378 9:136583443-136583465 CCAGCTCGAGAAACCCTAGCCTG No data
Right 1062443393 9:136583486-136583508 GCTGGGGACGCTCCCTCCATAGG No data
1062443378_1062443389 2 Left 1062443378 9:136583443-136583465 CCAGCTCGAGAAACCCTAGCCTG No data
Right 1062443389 9:136583468-136583490 CCTGGTTGTGCCTCAGGGGCTGG No data
1062443378_1062443394 29 Left 1062443378 9:136583443-136583465 CCAGCTCGAGAAACCCTAGCCTG No data
Right 1062443394 9:136583495-136583517 GCTCCCTCCATAGGCTTCCCAGG No data
1062443378_1062443386 -2 Left 1062443378 9:136583443-136583465 CCAGCTCGAGAAACCCTAGCCTG No data
Right 1062443386 9:136583464-136583486 TGGCCCTGGTTGTGCCTCAGGGG No data
1062443378_1062443390 3 Left 1062443378 9:136583443-136583465 CCAGCTCGAGAAACCCTAGCCTG No data
Right 1062443390 9:136583469-136583491 CTGGTTGTGCCTCAGGGGCTGGG No data
1062443378_1062443385 -3 Left 1062443378 9:136583443-136583465 CCAGCTCGAGAAACCCTAGCCTG No data
Right 1062443385 9:136583463-136583485 CTGGCCCTGGTTGTGCCTCAGGG No data
1062443378_1062443384 -4 Left 1062443378 9:136583443-136583465 CCAGCTCGAGAAACCCTAGCCTG No data
Right 1062443384 9:136583462-136583484 CCTGGCCCTGGTTGTGCCTCAGG No data
1062443378_1062443391 4 Left 1062443378 9:136583443-136583465 CCAGCTCGAGAAACCCTAGCCTG No data
Right 1062443391 9:136583470-136583492 TGGTTGTGCCTCAGGGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062443378 Original CRISPR CAGGCTAGGGTTTCTCGAGC TGG (reversed) Intergenic
No off target data available for this crispr