ID: 1062444563

View in Genome Browser
Species Human (GRCh38)
Location 9:136588197-136588219
Sequence TCCCAGGTTGCACACCCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062444554_1062444563 9 Left 1062444554 9:136588165-136588187 CCTGGCTCCTGAGCAGGTGTGCG No data
Right 1062444563 9:136588197-136588219 TCCCAGGTTGCACACCCCCATGG No data
1062444553_1062444563 10 Left 1062444553 9:136588164-136588186 CCCTGGCTCCTGAGCAGGTGTGC No data
Right 1062444563 9:136588197-136588219 TCCCAGGTTGCACACCCCCATGG No data
1062444555_1062444563 2 Left 1062444555 9:136588172-136588194 CCTGAGCAGGTGTGCGCCCCCCA No data
Right 1062444563 9:136588197-136588219 TCCCAGGTTGCACACCCCCATGG No data
1062444551_1062444563 15 Left 1062444551 9:136588159-136588181 CCAGACCCTGGCTCCTGAGCAGG No data
Right 1062444563 9:136588197-136588219 TCCCAGGTTGCACACCCCCATGG No data
1062444550_1062444563 23 Left 1062444550 9:136588151-136588173 CCGCTCAGCCAGACCCTGGCTCC No data
Right 1062444563 9:136588197-136588219 TCCCAGGTTGCACACCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062444563 Original CRISPR TCCCAGGTTGCACACCCCCA TGG Intergenic
No off target data available for this crispr