ID: 1062447620

View in Genome Browser
Species Human (GRCh38)
Location 9:136602217-136602239
Sequence CCCCGGCCGCAGGAGTCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062447620_1062447628 19 Left 1062447620 9:136602217-136602239 CCACGGGACTCCTGCGGCCGGGG No data
Right 1062447628 9:136602259-136602281 AGAGTACCTCATCCTCATCCCGG No data
1062447620_1062447629 20 Left 1062447620 9:136602217-136602239 CCACGGGACTCCTGCGGCCGGGG No data
Right 1062447629 9:136602260-136602282 GAGTACCTCATCCTCATCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062447620 Original CRISPR CCCCGGCCGCAGGAGTCCCG TGG (reversed) Intergenic
No off target data available for this crispr