ID: 1062447782

View in Genome Browser
Species Human (GRCh38)
Location 9:136602830-136602852
Sequence GTGTAGGAATGGTGGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062447782_1062447788 -4 Left 1062447782 9:136602830-136602852 CCAGCATCCCACCATTCCTACAC No data
Right 1062447788 9:136602849-136602871 ACACCAAGGTTCTGTTGCTTTGG No data
1062447782_1062447793 30 Left 1062447782 9:136602830-136602852 CCAGCATCCCACCATTCCTACAC No data
Right 1062447793 9:136602883-136602905 CCTCCGAGCTTATGAAGTGTGGG No data
1062447782_1062447791 29 Left 1062447782 9:136602830-136602852 CCAGCATCCCACCATTCCTACAC No data
Right 1062447791 9:136602882-136602904 GCCTCCGAGCTTATGAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062447782 Original CRISPR GTGTAGGAATGGTGGGATGC TGG (reversed) Intergenic
No off target data available for this crispr