ID: 1062448103

View in Genome Browser
Species Human (GRCh38)
Location 9:136604195-136604217
Sequence GGCCGGGGTGGGCAACGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062448090_1062448103 30 Left 1062448090 9:136604142-136604164 CCAGGCAGGGCTGGGACTTCCTG No data
Right 1062448103 9:136604195-136604217 GGCCGGGGTGGGCAACGTCCTGG No data
1062448092_1062448103 11 Left 1062448092 9:136604161-136604183 CCTGACGGACTGTGTGTCCGAGC No data
Right 1062448103 9:136604195-136604217 GGCCGGGGTGGGCAACGTCCTGG No data
1062448097_1062448103 -6 Left 1062448097 9:136604178-136604200 CCGAGCGGCTGGTTGGAGGCCGG No data
Right 1062448103 9:136604195-136604217 GGCCGGGGTGGGCAACGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062448103 Original CRISPR GGCCGGGGTGGGCAACGTCC TGG Intergenic
No off target data available for this crispr