ID: 1062448608

View in Genome Browser
Species Human (GRCh38)
Location 9:136606215-136606237
Sequence ACCCGCCAGAGGCAAGGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062448595_1062448608 29 Left 1062448595 9:136606163-136606185 CCTGGACGGCAGCTCTTGGCTGG No data
Right 1062448608 9:136606215-136606237 ACCCGCCAGAGGCAAGGCCCCGG No data
1062448602_1062448608 4 Left 1062448602 9:136606188-136606210 CCCAGGCAGGACCTGAGGCTATT No data
Right 1062448608 9:136606215-136606237 ACCCGCCAGAGGCAAGGCCCCGG No data
1062448594_1062448608 30 Left 1062448594 9:136606162-136606184 CCCTGGACGGCAGCTCTTGGCTG No data
Right 1062448608 9:136606215-136606237 ACCCGCCAGAGGCAAGGCCCCGG No data
1062448603_1062448608 3 Left 1062448603 9:136606189-136606211 CCAGGCAGGACCTGAGGCTATTT No data
Right 1062448608 9:136606215-136606237 ACCCGCCAGAGGCAAGGCCCCGG No data
1062448601_1062448608 5 Left 1062448601 9:136606187-136606209 CCCCAGGCAGGACCTGAGGCTAT No data
Right 1062448608 9:136606215-136606237 ACCCGCCAGAGGCAAGGCCCCGG No data
1062448604_1062448608 -7 Left 1062448604 9:136606199-136606221 CCTGAGGCTATTTCCAACCCGCC No data
Right 1062448608 9:136606215-136606237 ACCCGCCAGAGGCAAGGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062448608 Original CRISPR ACCCGCCAGAGGCAAGGCCC CGG Intergenic
No off target data available for this crispr