ID: 1062450122

View in Genome Browser
Species Human (GRCh38)
Location 9:136611671-136611693
Sequence GGCTGACTCCACACCTCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062450122_1062450133 21 Left 1062450122 9:136611671-136611693 CCCTGCGAGGTGTGGAGTCAGCC No data
Right 1062450133 9:136611715-136611737 CTCACATTGCCACCTGCCTCCGG No data
1062450122_1062450124 -8 Left 1062450122 9:136611671-136611693 CCCTGCGAGGTGTGGAGTCAGCC No data
Right 1062450124 9:136611686-136611708 AGTCAGCCCCTGCGCGTGCCCGG No data
1062450122_1062450134 26 Left 1062450122 9:136611671-136611693 CCCTGCGAGGTGTGGAGTCAGCC No data
Right 1062450134 9:136611720-136611742 ATTGCCACCTGCCTCCGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062450122 Original CRISPR GGCTGACTCCACACCTCGCA GGG (reversed) Intergenic