ID: 1062450123

View in Genome Browser
Species Human (GRCh38)
Location 9:136611672-136611694
Sequence GGGCTGACTCCACACCTCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062450123_1062450134 25 Left 1062450123 9:136611672-136611694 CCTGCGAGGTGTGGAGTCAGCCC No data
Right 1062450134 9:136611720-136611742 ATTGCCACCTGCCTCCGGTGTGG No data
1062450123_1062450124 -9 Left 1062450123 9:136611672-136611694 CCTGCGAGGTGTGGAGTCAGCCC No data
Right 1062450124 9:136611686-136611708 AGTCAGCCCCTGCGCGTGCCCGG No data
1062450123_1062450133 20 Left 1062450123 9:136611672-136611694 CCTGCGAGGTGTGGAGTCAGCCC No data
Right 1062450133 9:136611715-136611737 CTCACATTGCCACCTGCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062450123 Original CRISPR GGGCTGACTCCACACCTCGC AGG (reversed) Intergenic