ID: 1062450125

View in Genome Browser
Species Human (GRCh38)
Location 9:136611692-136611714
Sequence TGGGGACCGGGCACGCGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062450125_1062450141 21 Left 1062450125 9:136611692-136611714 CCCCTGCGCGTGCCCGGTCCCCA No data
Right 1062450141 9:136611736-136611758 GGTGTGGCTGCGAAGTCGGAGGG No data
1062450125_1062450140 20 Left 1062450125 9:136611692-136611714 CCCCTGCGCGTGCCCGGTCCCCA No data
Right 1062450140 9:136611735-136611757 CGGTGTGGCTGCGAAGTCGGAGG No data
1062450125_1062450138 17 Left 1062450125 9:136611692-136611714 CCCCTGCGCGTGCCCGGTCCCCA No data
Right 1062450138 9:136611732-136611754 CTCCGGTGTGGCTGCGAAGTCGG No data
1062450125_1062450134 5 Left 1062450125 9:136611692-136611714 CCCCTGCGCGTGCCCGGTCCCCA No data
Right 1062450134 9:136611720-136611742 ATTGCCACCTGCCTCCGGTGTGG No data
1062450125_1062450133 0 Left 1062450125 9:136611692-136611714 CCCCTGCGCGTGCCCGGTCCCCA No data
Right 1062450133 9:136611715-136611737 CTCACATTGCCACCTGCCTCCGG No data
1062450125_1062450142 24 Left 1062450125 9:136611692-136611714 CCCCTGCGCGTGCCCGGTCCCCA No data
Right 1062450142 9:136611739-136611761 GTGGCTGCGAAGTCGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062450125 Original CRISPR TGGGGACCGGGCACGCGCAG GGG (reversed) Intergenic