ID: 1062450126

View in Genome Browser
Species Human (GRCh38)
Location 9:136611693-136611715
Sequence GTGGGGACCGGGCACGCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062450126_1062450133 -1 Left 1062450126 9:136611693-136611715 CCCTGCGCGTGCCCGGTCCCCAC No data
Right 1062450133 9:136611715-136611737 CTCACATTGCCACCTGCCTCCGG No data
1062450126_1062450142 23 Left 1062450126 9:136611693-136611715 CCCTGCGCGTGCCCGGTCCCCAC No data
Right 1062450142 9:136611739-136611761 GTGGCTGCGAAGTCGGAGGGAGG No data
1062450126_1062450140 19 Left 1062450126 9:136611693-136611715 CCCTGCGCGTGCCCGGTCCCCAC No data
Right 1062450140 9:136611735-136611757 CGGTGTGGCTGCGAAGTCGGAGG No data
1062450126_1062450138 16 Left 1062450126 9:136611693-136611715 CCCTGCGCGTGCCCGGTCCCCAC No data
Right 1062450138 9:136611732-136611754 CTCCGGTGTGGCTGCGAAGTCGG No data
1062450126_1062450141 20 Left 1062450126 9:136611693-136611715 CCCTGCGCGTGCCCGGTCCCCAC No data
Right 1062450141 9:136611736-136611758 GGTGTGGCTGCGAAGTCGGAGGG No data
1062450126_1062450134 4 Left 1062450126 9:136611693-136611715 CCCTGCGCGTGCCCGGTCCCCAC No data
Right 1062450134 9:136611720-136611742 ATTGCCACCTGCCTCCGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062450126 Original CRISPR GTGGGGACCGGGCACGCGCA GGG (reversed) Intergenic
No off target data available for this crispr