ID: 1062450127

View in Genome Browser
Species Human (GRCh38)
Location 9:136611694-136611716
Sequence AGTGGGGACCGGGCACGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062450127_1062450138 15 Left 1062450127 9:136611694-136611716 CCTGCGCGTGCCCGGTCCCCACT No data
Right 1062450138 9:136611732-136611754 CTCCGGTGTGGCTGCGAAGTCGG No data
1062450127_1062450142 22 Left 1062450127 9:136611694-136611716 CCTGCGCGTGCCCGGTCCCCACT No data
Right 1062450142 9:136611739-136611761 GTGGCTGCGAAGTCGGAGGGAGG No data
1062450127_1062450134 3 Left 1062450127 9:136611694-136611716 CCTGCGCGTGCCCGGTCCCCACT No data
Right 1062450134 9:136611720-136611742 ATTGCCACCTGCCTCCGGTGTGG No data
1062450127_1062450133 -2 Left 1062450127 9:136611694-136611716 CCTGCGCGTGCCCGGTCCCCACT No data
Right 1062450133 9:136611715-136611737 CTCACATTGCCACCTGCCTCCGG No data
1062450127_1062450140 18 Left 1062450127 9:136611694-136611716 CCTGCGCGTGCCCGGTCCCCACT No data
Right 1062450140 9:136611735-136611757 CGGTGTGGCTGCGAAGTCGGAGG No data
1062450127_1062450141 19 Left 1062450127 9:136611694-136611716 CCTGCGCGTGCCCGGTCCCCACT No data
Right 1062450141 9:136611736-136611758 GGTGTGGCTGCGAAGTCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062450127 Original CRISPR AGTGGGGACCGGGCACGCGC AGG (reversed) Intergenic
No off target data available for this crispr