ID: 1062450128

View in Genome Browser
Species Human (GRCh38)
Location 9:136611704-136611726
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062450128_1062450138 5 Left 1062450128 9:136611704-136611726 CCCGGTCCCCACTCACATTGCCA No data
Right 1062450138 9:136611732-136611754 CTCCGGTGTGGCTGCGAAGTCGG No data
1062450128_1062450134 -7 Left 1062450128 9:136611704-136611726 CCCGGTCCCCACTCACATTGCCA No data
Right 1062450134 9:136611720-136611742 ATTGCCACCTGCCTCCGGTGTGG No data
1062450128_1062450145 29 Left 1062450128 9:136611704-136611726 CCCGGTCCCCACTCACATTGCCA No data
Right 1062450145 9:136611756-136611778 GGGAGGAGAGAGCCAGCCAGGGG No data
1062450128_1062450142 12 Left 1062450128 9:136611704-136611726 CCCGGTCCCCACTCACATTGCCA No data
Right 1062450142 9:136611739-136611761 GTGGCTGCGAAGTCGGAGGGAGG No data
1062450128_1062450143 27 Left 1062450128 9:136611704-136611726 CCCGGTCCCCACTCACATTGCCA No data
Right 1062450143 9:136611754-136611776 GAGGGAGGAGAGAGCCAGCCAGG No data
1062450128_1062450144 28 Left 1062450128 9:136611704-136611726 CCCGGTCCCCACTCACATTGCCA No data
Right 1062450144 9:136611755-136611777 AGGGAGGAGAGAGCCAGCCAGGG No data
1062450128_1062450141 9 Left 1062450128 9:136611704-136611726 CCCGGTCCCCACTCACATTGCCA No data
Right 1062450141 9:136611736-136611758 GGTGTGGCTGCGAAGTCGGAGGG No data
1062450128_1062450140 8 Left 1062450128 9:136611704-136611726 CCCGGTCCCCACTCACATTGCCA No data
Right 1062450140 9:136611735-136611757 CGGTGTGGCTGCGAAGTCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062450128 Original CRISPR TGGCAATGTGAGTGGGGACC GGG (reversed) Intergenic